SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


sporulation protein
10.29 kDa
protein length
gene length
276 bp Sequence Blast
sporulation protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    3,354,212 → 3,354,487

    Expression and Regulation



    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,9852018], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|9852018], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|15699190,9852018]
  • view in new tab

    Biological materials


  • BKE32650 (Δ[gene|B46AB216DE0828E4CD5714CADE5C25C1B5AF75DC|yurS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAGTCTTCTCCGTCTTG, downstream forward: _UP4_TAAAAAACCGCGGCCCCTCG
  • BKK32650 (Δ[gene|B46AB216DE0828E4CD5714CADE5C25C1B5AF75DC|yurS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAGTCTTCTCCGTCTTG, downstream forward: _UP4_TAAAAAACCGCGGCCCCTCG
  • References

  • 9852018,15699190,12850135