SubtiBank SubtiBank
rocE
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

rocE

amino acid permease
locus
BSU_40330
pI
8.53
mw
51.47 kDa
protein length
467 aa Sequence Blast
gene length
1404 bp Sequence Blast
function
arginine, ornithine and citrulline uptake
product
amino acid permease
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.4|APC superfamily]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.4|Biosynthesis/ acquisition of arginine]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.4|Utilization of arginine/ ornithine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    4,142,675 → 4,144,078

    The protein

    Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|B6A920650919D5BBBD75CCA58C30A0D8ECE64DA3|YbgF], [protein|C7FEA1D9C7C96C39CEE83CE3F13D412DE6AFE10E|YdgF], [protein|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|AapA], [protein|1594BA83CED2DA9F86C1CE2A0DC6E1C9B665EACB|GabP], [protein|219586A3F378DC38EA076FD39B99D41136BDE722|YtnA], [protein|423AEC9D260BE53AD22851D999244B89BEB3E84D|HutM], [protein|8C4A8961B2514A8AD531AFB104B10C0797D02AC2|YvbW], [protein|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|YbxG], [protein|9BFB16C12B31ABD70BBB921BCB9E4201E3BDC92D|RocC]
  • Structure

  • [PDB|6F34] (from Geobacillus kaustophilus, 23% identity) [pubmed|29416041]
  • [SW|Localization]

  • cell membrane (according to UniProt), membrane associated [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|617FE9E40E8822D58B0446128585CB6CA05A50C6|rocD]-[gene|B46A8BCEC56E6252712E30F8BF8DA6B836FDE2F6|rocE]-[gene|CD121BBF1DC206D1189ECF8B32456641A55C41D4|rocF]
    description
    [Pubmed|7540694]

    sigma factors

  • [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]: sigma factor, [Pubmed|7540694], in [regulon|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC]: activation, [Pubmed|7540694], in [regulon|62F8E0D6BC9DA6390256FA8FB684EA5C9C722AE4|AhrC regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR]: activation, [Pubmed|7540694], in [regulon|BEE6F16D6A5BBC7FED9E8EB5FA6A94BBF932BBDA|RocR regulon]
  • regulation

  • induced by arginine ([protein|search|RocR], [protein|search|AhrC]) [Pubmed|7540694]
  • additional information

  • expression of the ''[protein|search|rocD]-[protein|search|rocE]-[protein|search|rocF]'' operon is increased upon depletion of ''[SW|nusA]'' (resulting from increased ''[SW|ahrC]'' expression) [http://www.nature.com/articles/nmicrobiol20157 Reference]
  • view in new tab

    Biological materials

    Mutant

  • GP1690 Δ[gene|B46A8BCEC56E6252712E30F8BF8DA6B836FDE2F6|rocE]::''tet'', available in [SW|Jörg Stülke]'s lab
  • BKE40330 (Δ[gene|B46A8BCEC56E6252712E30F8BF8DA6B836FDE2F6|rocE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATTCTGCACCCCTTCAG, downstream forward: _UP4_TAAAAACGTTGTCCGCAAGT
  • BKK40330 (Δ[gene|B46A8BCEC56E6252712E30F8BF8DA6B836FDE2F6|rocE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATTCTGCACCCCTTCAG, downstream forward: _UP4_TAAAAACGTTGTCCGCAAGT
  • References

  • 14651647,12618455,18763711,7540694,29416041