SubtiBank SubtiBank
yqbF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqbF

unknown
locus
BSU26130
pI
7.03
mw
11.71 kDa
protein length
103 aa Sequence Blast
gene length
312 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,682,885 → 2,683,196

    The protein

    Structure

  • [PDB|2HJQ] (NMR)
  • Biological materials

    Mutant

  • BKE26130 (Δ[gene|B4568166F5A9D6B2BF0302DCB423386CAA91D0E5|yqbF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTTGCAGTAAACACACCAG, downstream forward: _UP4_ATAGATAACAAAGGGGAGTG
  • BKK26130 (Δ[gene|B4568166F5A9D6B2BF0302DCB423386CAA91D0E5|yqbF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTTGCAGTAAACACACCAG, downstream forward: _UP4_ATAGATAACAAAGGGGAGTG