SubtiBank SubtiBank
yqbF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqbF

unknown
locus
BSU_26130
pI
7.03
mw
11.71 kDa
protein length
103 aa Sequence Blast
gene length
312 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,682,885 → 2,683,196

    The protein

    Structure

  • [PDB|2HJQ] (NMR)
  • Biological materials

    Mutant

  • BKE26130 (Δ[gene|B4568166F5A9D6B2BF0302DCB423386CAA91D0E5|yqbF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTTGCAGTAAACACACCAG, downstream forward: _UP4_ATAGATAACAAAGGGGAGTG
  • BKK26130 (Δ[gene|B4568166F5A9D6B2BF0302DCB423386CAA91D0E5|yqbF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTTGCAGTAAACACACCAG, downstream forward: _UP4_ATAGATAACAAAGGGGAGTG