SubtiBank SubtiBank
ylaD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ylaD

redox sensor, control of sigma factor [protein|544344B61A804F367BB726976E0C87B61998490A|YlaC]
locus
BSU_14740
pI
4.47
mw
11.27 kDa
protein length
gene length
294 bp Sequence Blast
function
control of sigma factor [protein|544344B61A804F367BB726976E0C87B61998490A|YlaC]
product
anti-Sigma ([protein|544344B61A804F367BB726976E0C87B61998490A|YlaC])
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,544,603 → 1,544,896

    The protein

    Protein family

  • zinc-associated anti-sigma factor (ZAS) superfamily (with [protein|4E720917045032E8B45CB8AF6E5C13AE0E48EE33|RsiW], according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|6BB9336E8F5007274026A89BFC3744B52F28E42D|ylaA]-[gene|0703D458DB489F49150DD9E3477A87DC354A7B7F|ylaB]-[gene|544344B61A804F367BB726976E0C87B61998490A|ylaC]-[gene|B454D14B33E2C11F0BB0A1D1BB743FA64981A966|ylaD]
    description
    [Pubmed|16501307]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16501307], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|544344B61A804F367BB726976E0C87B61998490A|YlaC]: sigma factor, [Pubmed|16501307], in [regulon|544344B61A804F367BB726976E0C87B61998490A|YlaC regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|16501307], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • [protein|search|Spx]: transcription activation [Pubmed|16501307]
  • view in new tab

    genes
    [gene|544344B61A804F367BB726976E0C87B61998490A|ylaC]-[gene|B454D14B33E2C11F0BB0A1D1BB743FA64981A966|ylaD]
    description
    [Pubmed|16501307]

    regulation

  • [protein|search|Spx]: transcription activation [Pubmed|16501307]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A535 (ylaD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/535 NBRP B. subtilis, Japan]
  • BKE14740 (Δ[gene|B454D14B33E2C11F0BB0A1D1BB743FA64981A966|ylaD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGTCATATCCGCTCCTCCTC, downstream forward: _UP4_TAAAAAAAGCGCTTGTCCGA
  • BKK14740 (Δ[gene|B454D14B33E2C11F0BB0A1D1BB743FA64981A966|ylaD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GGTCATATCCGCTCCTCCTC, downstream forward: _UP4_TAAAAAAAGCGCTTGTCCGA
  • References

  • 16501307,16728958,29760236