SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


cystine and diaminopimelate [SW|ABC transporter], ATP-binding protein
27.64 kDa
protein length
247 aa Sequence Blast
gene length
744 bp Sequence Blast
cystine and diaminopimelate uptake
cystine and diaminopimelate [SW|ABC transporter], ATP-binding protein

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of amino acids]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of cysteine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    409,208 → 409,951

    The protein

    Catalyzed reaction/ biological activity

  • uptake of cystine and diaminopimelate [pubmed|29995990]
  • Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|F8C800CF71D21A1F3265977C4F0EE191D0FFE36A|YxeO], [protein|0D5BC94E21D51373A50D61CE3D0895B3DB28F6B3|PstBB], [protein|0F8048267EC038D8CF673317D969BA27735473A7|YvrO], [protein|468BEA9EAEA589D683DB79B2C689A5C6A22AB67F|GlnQ], [protein|6882EF93EC82872B25C88104F62D6603D2514890|ArtR], [protein|B24763A732111026D21C828FF9BE73FB22A123CF|TcyN], [protein|434BCED6953BE07D592AC229264C5AD0D04CBAF6|PstBA]
  • Structure

  • [PDB|2Q0H] (in complex with ADP-Mg2+, Geobacillus stearothermophilus, 55% identity)
  • [SW|Localization]

  • attached to the membrane via [protein|9400DF25487461E3738DDDC72BDDB1589281409D|TcyB] [Pubmed|10092453]
  • Expression and Regulation




  • strongly repressed in response to glucose starvation in M9 medium [Pubmed|23033921]
  • view in new tab

    Biological materials


  • MGNA-C004 (yckI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE03590 (Δ[gene|B453986691E1231A1C565D469A2A60EBFF2F6BD3|tcyC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AACGGTAAGCATACTCGGAA, downstream forward: _UP4_TAATAAGAAAAACAGAGCGT
  • BKK03590 (Δ[gene|B453986691E1231A1C565D469A2A60EBFF2F6BD3|tcyC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AACGGTAAGCATACTCGGAA, downstream forward: _UP4_TAATAAGAAAAACAGAGCGT
  • References

  • 15262924,10092453,7551042,29995990