SubtiBank SubtiBank
spoVAEA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

spoVAEA

stage V sporulation germinant protein, essential for the transport of the 1:1 chelate of pyridine-2,6-dicarboxylic acid (DPA(2,6)) and Ca(2 )
locus
BSU23401
pI
5.00
mw
22.00 kDa
protein length
203 aa Sequence Blast
gene length
612 bp Sequence Blast
function
spore germination
product
stage V sporulation germinant protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.2|Additional germination proteins]
  • Gene

    Coordinates
    2,439,804 → 2,440,415

    Phenotypes of a mutant

  • delayed germination with germinant receptor-dependent germinants [Pubmed|24682327]
  • The protein

    [SW|Localization]

  • outer surface of the spore's inner membrane [Pubmed|24682327]
  • Expression and Regulation

    Operons

    genes
    [gene|5410018998EC9792A69CF0D9C438EEF5AC8A82C5|spoVAA]-[gene|AEC70413BDC29F435776D532E7049AA9A0BD893D|spoVAB]-[gene|B280951A232E941FB0A6C8834049765BE1E16437|spoVAC]-[gene|9531F0A0DC4AE5696FFBAC9C2A773F15840E3255|spoVAD]-[gene|31D6CB7EC20C39C1815CA4552B8B9C4BE304E86B|spoVAEB]-[gene|B44529B69769D7AF1010E06C95E398EA91A3E798|spoVAEA]-[gene|CBE5093DFBBCE25071CCE12408BC9AFF7A158C03|spoVAF]-[gene|02F1C926D200DE85C93A0ACEF23AD25FBD12B0BD|lysA]
    description
    [Pubmed|7934830]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,1903432], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: activation, [Pubmed|8755877], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG], [SW|SpoVT]) [Pubmed|15699190,1903432,8755877]
  • view in new tab

    Biological materials

    Mutant

  • BKE23401 (Δ[gene|B44529B69769D7AF1010E06C95E398EA91A3E798|spoVAEA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23401 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTGCGTTTTGTCGTCATGT, downstream forward: _UP4_TTTATTTTAGAAAGGAGCGG
  • BKK23401 (Δ[gene|B44529B69769D7AF1010E06C95E398EA91A3E798|spoVAEA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23401 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTGCGTTTTGTCGTCATGT, downstream forward: _UP4_TTTATTTTAGAAAGGAGCGG
  • labs

  • [SW|Peter Setlow], University of Connecticut Health Center, USA
  • References

  • 17573930,3114420,11751839,15451103,3926949,17158659,6432957,7934830,22328679,15699190,1903432,8755877,22343299,24682327,26731423