SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


may be involved in protection against methyl-hydroquinone
13.14 kDa
protein length
129 aa Sequence Blast
gene length
390 bp Sequence Blast
may be involved in protection against methyl-hydroquinone

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    598,154 → 598,543

    The protein

    Protein family

  • DoxX family (with [protein|B7A0D1B3CAA2733A33BCCDDB6774ABF1A0223473|CatD], according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|17725564], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11532142], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|997B828A99D6D8460712C18ED0CE566B285C22DC|MhqR]: repression, [Pubmed|17725564], in [regulon|997B828A99D6D8460712C18ED0CE566B285C22DC|MhqR regulon]
  • regulation

  • induced by catechol and 2-methylhydroquinone ([protein|search|MhqR]) [Pubmed|17725564]
  • view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|17725564], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|997B828A99D6D8460712C18ED0CE566B285C22DC|MhqR]: repression, [Pubmed|17725564], in [regulon|997B828A99D6D8460712C18ED0CE566B285C22DC|MhqR regulon]
  • regulation

  • induced by catechol and 2-methylhydroquinone ([protein|search|MhqR]) [Pubmed|17725564]
  • view in new tab

    Biological materials


  • MGNA-C169 (ydfP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE05500 (Δ[gene|B4384C8C0874BAA7822E9B6DCAB57790018271D8|mhqP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTATCTCTCCTCATC, downstream forward: _UP4_TAATACGAAAGTATGTAAGA
  • BKK05500 (Δ[gene|B4384C8C0874BAA7822E9B6DCAB57790018271D8|mhqP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTATCTCTCCTCATC, downstream forward: _UP4_TAATACGAAAGTATGTAAGA
  • References

  • 17407181,17725564,11532142,27965289