SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


sporulation protein, transporter for 3-hydroxybutyrate
49.98 kDa
protein length
472 aa Sequence Blast
gene length
1419 bp Sequence Blast
3-hydroxybutyrate utilization
transporter for 3-hydroxybutyrate

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Transporter for organic acids]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    4,002,716 → 4,004,134

    Phenotypes of a mutant

  • reduced uptake of 3-hydroxybutyrate during [SW|sporulation] [Pubmed|26363016]
  • The protein

    Catalyzed reaction/ biological activity

  • uptake of 3-hydroxybutyrate [Pubmed|26363016]
  • Protein family

  • [SW|CitM transporter family (TC 2.A.11)] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|12662922], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135,10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|12662922]
  • view in new tab

    Biological materials


  • MGNA-B727 (yxjC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE39000 (Δ[gene|B416BB368A96926526458B2258BF8AB928D7C15E|hbuT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACACACACATCCCCCGTTT, downstream forward: _UP4_TAGAAGAAAACGAAAGGGGC
  • BKK39000 (Δ[gene|B416BB368A96926526458B2258BF8AB928D7C15E|hbuT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACACACACATCCCCCGTTT, downstream forward: _UP4_TAGAAGAAAACGAAAGGGGC
  • References

  • 16672620,10746760,12662922,12850135,10666464,26363016