SubtiBank SubtiBank
hbuT
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

hbuT

sporulation protein, transporter for 3-hydroxybutyrate
locus
BSU_39000
pI
8.90
mw
49.98 kDa
protein length
472 aa Sequence Blast
gene length
1419 bp Sequence Blast
function
3-hydroxybutyrate utilization
product
transporter for 3-hydroxybutyrate
essential
no
synonyms
yxjC

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.4|Transporter for organic acids]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    4,002,716 → 4,004,134

    Phenotypes of a mutant

  • reduced uptake of 3-hydroxybutyrate during [SW|sporulation] [Pubmed|26363016]
  • The protein

    Catalyzed reaction/ biological activity

  • uptake of 3-hydroxybutyrate [Pubmed|26363016]
  • Protein family

  • [SW|CitM transporter family (TC 2.A.11)] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|B416BB368A96926526458B2258BF8AB928D7C15E|hbuT]-[gene|A7E61C3D12BBDDD3EFD65B1EDBE280497D7B6CD0|scoA]-[gene|7F46EDA8F1EB8D9817C62D7D361FF32F9CD814AD|scoB]-[gene|B7B1D28E50244704324920E5A6F110DA8D63F6C0|yxjF]
    description
    [Pubmed|10746760]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|12662922], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135,10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|12662922]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B727 (yxjC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1726 NBRP B. subtilis, Japan]
  • BKE39000 (Δ[gene|B416BB368A96926526458B2258BF8AB928D7C15E|hbuT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACACACACATCCCCCGTTT, downstream forward: _UP4_TAGAAGAAAACGAAAGGGGC
  • BKK39000 (Δ[gene|B416BB368A96926526458B2258BF8AB928D7C15E|hbuT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACACACACATCCCCCGTTT, downstream forward: _UP4_TAGAAGAAAACGAAAGGGGC
  • References

  • 16672620,10746760,12662922,12850135,10666464,26363016