SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


DNA-end-binding protein Ku, non-homologous end joining DNA repair
34.91 kDa
protein length
311 aa Sequence Blast
gene length
936 bp Sequence Blast
non-homologous end joining DNA repair, repair of gapped DNA substrates
DNA-end-binding protein Ku

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Spore-encoded non-homologous end joining system]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    1,406,357 → 1,407,292

    Phenotypes of a mutant

  • sensitivity to ionizing radiation in the stationary phase [Pubmed|12215643]
  • sensitivity of spores to several DNA-damaging treatments known to cause double strand breaks, such as UV-ray, X-ray, ultrahigh vacuum and wet heat [Pubmed|16497325,17293412]
  • a ''[gene|B3E1652E9F3BDC9520847C479A2C0BED25025B4C|ykoV]-[gene|127CB0930A2D96B18D9261180028818F158C68CB|ligD]'' double mutant is sensitive to radiation [Pubmed|24123749]
  • reduced resistance towards electron beams [pubmed|31948638]
  • The protein

    Catalyzed reaction/ biological activity

  • stimulation of [protein|127CB0930A2D96B18D9261180028818F158C68CB|LigD] non-homologous end-joining activity [Pubmed|23691176,26961308]
  • binds at the DNA double-strand breaks and recruits the ligase [protein|search|LigD ]to seal the break [pubmed|15778718,16518468]
  • Protein family

  • prokaryotic Ku family (single member, according to UniProt)
  • [SW|Domains]

  • KU domain (aa 26-210) (according to UniProt)
  • [SW|Localization]

  • associates with the nucleoid during germination [Pubmed|16497325]
  • Expression and Regulation



    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16497325], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: activation, [Pubmed|16497325], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigG], [SW|SpoVT]) [Pubmed|16497325]
  • view in new tab

    Biological materials


  • MGNA-A779 (ykoV::erm), available at the [ NBRP B. subtilis, Japan]
  • BP141 (Δ''[gene|B3E1652E9F3BDC9520847C479A2C0BED25025B4C|ykoV]-[gene|127CB0930A2D96B18D9261180028818F158C68CB|ligD]''::''kan'') available in [SW|Fabian Commichau]'s lab
  • BP142 (Δ''[gene|A2E6852A5739B3C04405B98AFFC301A98E1ADCD0|dgcW]-[gene|B3E1652E9F3BDC9520847C479A2C0BED25025B4C|ykoV]-[gene|127CB0930A2D96B18D9261180028818F158C68CB|ligD]''::''kan'') available in [SW|Fabian Commichau]'s lab
  • BKE13410 (Δ[gene|B3E1652E9F3BDC9520847C479A2C0BED25025B4C|ykoV]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGTAGTAACTTATGGG, downstream forward: _UP4_AAAGCCTCCGGCACATCATA
  • BKK13410 (Δ[gene|B3E1652E9F3BDC9520847C479A2C0BED25025B4C|ykoV]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGTAGTAACTTATGGG, downstream forward: _UP4_AAAGCCTCCGGCACATCATA
  • References


  • 11591342,11719239,17938628,22933559,30746801
  • Original publications

  • 16497325,11483577,23691176,12215643,17293412,24123749,25355514,26961308,15778718,16518468,29234047,30976810,31948638