putP

high affinity proline permease

Locus: BSU_03220

Isoelectric point: 8.62

Molecular weight: 48.25 kDa

Protein length: 473 aa

Gene length: 1422 bp

Function: proline uptake

Product: high affinity proline permease

Essential: no

Synonyms: ycgO

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Transporters → Transporters/ other → Amino acid transporters → Solute:sodium symporter family
• Cellular processes → Transporters → Transporters/ other → Amino acid transporters → Sodium-solute symporter
• Metabolism → Amino acid/ nitrogen metabolism → Biosynthesis/ acquisition of amino acids → Biosynthesis/ acquisition of proline
• Metabolism → Amino acid/ nitrogen metabolism → Utilization of amino acids → Utilization of proline
• Groups of genes → Membrane proteins

Gene

Coordinates: 347,150 → 348,571

Phenotypes of a mutant

• no growth with proline as single source of carbon or nitrogen PubMed

The protein

Catalyzed reaction/ biological activity

• uptake of proline coupled to the uptake of sodium ions

Protein family

• sodium:solute symporter (SSF) (TC 2.A.21) family (according to UniProt)

Paralogous protein(s)

• OpuE

Structure

• 2XQ2 (from Vibrio parahaemolyticus, 26% identity) PubMed

Localization

• cell membrane (according to UniProt)

Expression and Regulation

Operons

• Genes: putP
  Description: (internal promoter) PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Additional information

  • the mRNA is cleaved by RNase III PubMed

• Genes: putB-putC-putP
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • PutR: activation, PubMed, in PutR regulon
  • Spo0A: activation, PubMed, in Spo0A regulon
  • CodY: repression, displacement of PutR PubMed, in CodY regulon

  Regulation

  • expressed under conditions that trigger sporulation (Spo0A) PubMed

  Additional information

  • overexpressed in a pnpA mutant PubMed
  • the putP part of the mRNA is cleaved by RNase III PubMed

Biological materials

Mutant

• MGNA-B994 (ycgO::erm), available at the NBRP B. subtilis, Japan
• available in Erhard Bremer's lab PubMed
• BKE03220 (ΔputP::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCCCGCCATATAAATAC, downstream forward: _UP4_TAAAGATCGAAAGGAGGAGG
• BKK03220 (ΔputP::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTCCCGCCATATAAATAC, downstream forward: _UP4_TAAAGATCGAAAGGAGGAGG

References

Loading