SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


high affinity proline permease
48.25 kDa
protein length
473 aa Sequence Blast
gene length
1422 bp Sequence Blast
proline uptake
high affinity proline permease

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Amino acid transporters] → [category|SW|Solute:sodium symporter family]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of proline]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of proline]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    347,150 → 348,571

    Phenotypes of a mutant

  • no growth with proline as single source of carbon or nitrogen [Pubmed|21840319]
  • The protein

    Catalyzed reaction/ biological activity

  • uptake of proline coupled to the uptake of sodium ions
  • Protein family

  • sodium solute symporter family (SSS; TC2A.21)
  • Paralogous protein(s)

  • [protein|6A1F759DAC09D364602460E5467E2761E97CE45C|OpuE]
  • Structure

  • [PDB|2XQ2] (from ''Vibrio parahaemolyticus'', 26% identity) [Pubmed|21131949]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    (internal promoter) [Pubmed|21840319]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21840319,21964733,22139509], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21840319,21964733,22139509], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|PutR]: activation, [Pubmed|21840319,21964733,22139509], in [regulon|C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|PutR regulon]
  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, displacement of [protein|C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|PutR] [Pubmed|21840319], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • additional information

  • overexpressed in a [gene|64C6D783FF3F41C81B216F798A1DC8071345B1ED|pnpA] mutant [PubMed|14976255]
  • the [gene|B3DF99B747D0A7472E3878920BF3CE7CE954B0BE|putP] part of the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • view in new tab

    Biological materials


  • MGNA-B994 (ycgO::erm), available at the [ NBRP B. subtilis, Japan]
  • available in [SW|Erhard Bremer]'s lab [Pubmed|24142252]
  • BKE03220 (Δ[gene|B3DF99B747D0A7472E3878920BF3CE7CE954B0BE|putP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCCGCCATATAAATAC, downstream forward: _UP4_TAAAGATCGAAAGGAGGAGG
  • BKK03220 (Δ[gene|B3DF99B747D0A7472E3878920BF3CE7CE954B0BE|putP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCCGCCATATAAATAC, downstream forward: _UP4_TAAAGATCGAAAGGAGGAGG
  • References

  • 21840319,21964733,22139509,24142252,21131949,26728461,26883633