SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcriptional regulator of the [SW|ArsR family], arsenic resistance operon repressor
12.15 kDa
protein length
105 aa Sequence Blast
gene length
318 bp Sequence Blast
regulation of As (III) efflux
transcription repressor ([SW|ArsR family])

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.11|Resistance against toxic metals]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    2,657,317 → 2,657,634

    The protein

    Protein family

  • [SW|ArsR family]
  • [SW|Domains]

  • [SW|HTH arsR-type domain] (aa 4-99) (according to UniProt)
  • Structure

  • [PDB|1U2W] (CadC from Staphylococcus aureus, 36% identity) [pubmed|15937183]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9537360], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|B3D88B9C89154B77D77FB833CA16FD4F4E29FE96|ArsR]: repression, [Pubmed|9537360], in [regulon|B3D88B9C89154B77D77FB833CA16FD4F4E29FE96|ArsR regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|16497325]
  • view in new tab

    Biological materials


  • BKE25810 (Δ[gene|B3D88B9C89154B77D77FB833CA16FD4F4E29FE96|arsR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATATCGCCTTCTTTA, downstream forward: _UP4_TAAAAAAATTTTTTAGGTAT
  • BKK25810 (Δ[gene|B3D88B9C89154B77D77FB833CA16FD4F4E29FE96|arsR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATATCGCCTTCTTTA, downstream forward: _UP4_TAAAAAAATTTTTTAGGTAT
  • References

  • 15948947,9537360,16497325,15937183