SubtiBank SubtiBank
yqfL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqfL

Modulator of [protein|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|CcpN] activity, similar to phosphoenolpyruvate synthetase regulatory protein
locus
BSU_25240
pI
5.78
mw
30.20 kDa
protein length
270 aa Sequence Blast
gene length
813 bp Sequence Blast
function
inhibits [protein|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|CcpN] activity
product
modulator of [protein|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|CcpN] activity
essential
no
ec
2.7.-.-
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.2|Gluconeogenesis]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.7|Control of transcription factor (other than two-component system)]
  • Gene

    Coordinates
    2,604,121 → 2,604,933

    The protein

    Catalyzed reaction/ biological activity

  • negative effector of [protein|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|CcpN] activity [Pubmed|15720552]
  • ADP + Nτ-phospho-L-histidyl/L-threonyl-[pyruvate, phosphate dikinase] --> AMP + H+ + Nτ-phospho-L-histidyl/O-phospho-L-threonyl-[pyruvate, phosphate dikinase] (according to UniProt)
  • H+ + Nτ-phospho-L-histidyl/O-phospho-L-threonyl-[pyruvate, phosphate dikinase] + phosphate --> diphosphate + Nτ-phospho-L-histidyl/L-threonyl-[pyruvate, phosphate dikinase] (according to UniProt)
  • Protein family

  • pyruvate, phosphate/water dikinase regulatory protein family (single member, according to UniProt)
  • [SW|Domains]

  • nucleotide binding domain (ATP) (151–158)
  • Structure

  • [PDB|5D0N] (from maize, 39% identity) [pubmed|26620526]
  • Expression and Regulation

    Operons

    genes
    [gene|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|ccpN]-[gene|B3C0FE9DD3CB4AF34DD57CF4D03ABE8AFF1346C7|yqfL]
    description
    [Pubmed|15720552]

    regulation

  • constitutive [Pubmed|15720552]
  • additional information

  • the intracellular concentration of CcpN is about 4 myM (according to [PubMed|20408793]).
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C492 (yqfL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2490 NBRP B. subtilis, Japan]
  • BKE25240 (Δ[gene|B3C0FE9DD3CB4AF34DD57CF4D03ABE8AFF1346C7|yqfL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTATCCCCCCGTTAGT, downstream forward: _UP4_TAACTCAGGACGCTCTATCC
  • BKK25240 (Δ[gene|B3C0FE9DD3CB4AF34DD57CF4D03ABE8AFF1346C7|yqfL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTATCCCCCCGTTAGT, downstream forward: _UP4_TAACTCAGGACGCTCTATCC
  • labs

  • [SW|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
  • References

  • 15720552,26620526,20044937