SubtiBank SubtiBank
cotZ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

cotZ

spore crust anchor protein, necessary for the assembly of the spore crust, the outermost layer of the spore coat
locus
BSU_11740
pI
5.00
mw
16.00 kDa
protein length
148 aa Sequence Blast
gene length
447 bp Sequence Blast
function
spore crust assembly
product
spore crust anchor protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.3|Class III]
  • Gene

    Coordinates
    1,249,442 → 1,249,888

    Phenotypes of a mutant

  • mis-assembly of the spore crust [Pubmed|22171814]
  • The protein

    Catalyzed reaction/ biological activity

  • required for the localization of most crust proteins [pubmed|30582883]
  • Paralogous protein(s)

  • [protein|B2636947990A303C43CEA8BFBE38811DD233A0A6|CotY]
  • [SW|Localization]

  • outermost layer of the spore coat (crust), localization depends on [protein|825AD8D4315A85CD384F9AF6AD894E38E57C88F7|CotE] [Pubmed|22171814]
  • more abundant at the mother cell-proximal pole of the forespore [Pubmed|19933362,21665972]
  • Expression and Regulation

    Operons

    genes
    [gene|B2636947990A303C43CEA8BFBE38811DD233A0A6|cotY]-[gene|B3BA3A44C3EE2747FB594BD7199864E9ECA953CB|cotZ]
    description
    [Pubmed|7519271]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|7519271,15699190], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|26577401,15383836], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|0D7F5504590512E1598B94DC1734BF8FF67ED994|GerR]: activation, [Pubmed|15621419], in [regulon|0D7F5504590512E1598B94DC1734BF8FF67ED994|GerR regulon]
  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|7519271], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|7519271,15699190]
  • view in new tab

    Biological materials

    Mutant

  • BKE11740 (Δ[gene|B3BA3A44C3EE2747FB594BD7199864E9ECA953CB|cotZ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTATCCCTCCTGCCTT, downstream forward: _UP4_TAATCATAAGCTGGAAAAGC
  • BKK11740 (Δ[gene|B3BA3A44C3EE2747FB594BD7199864E9ECA953CB|cotZ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTATCCCTCCTGCCTT, downstream forward: _UP4_TAATCATAAGCTGGAAAAGC
  • References

    Reviews

  • 22192522,23202530,27227299
  • Original publications

  • 19304857,7519271,15699190,19933362,20451384,21665972,22171814,15383836,26341943,15621419,27320701,28870294,30582883,31502725