SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


12.92 kDa
protein length
108 aa Sequence Blast
gene length
327 bp Sequence Blast

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.2|Mobile genetic elements] → [category|SW 5.2.1|ICEBs1]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    541,248 → 541,574

    Expression and Regulation



    regulatory mechanism

  • [protein|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|ImmR]: repression, [Pubmed|17511812], in [regulon|DD1C8F3A4809785BD6A6047D39B42AB2C605E161|ImmR regulon]
  • view in new tab

    Biological materials


  • BKE04950 (Δ[gene|B3A07E2A61151C33B7C65D1BC58B97BFDB76852D|yddF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCATGTACGATTCAACCC, downstream forward: _UP4_TTATTAACTCGGTTAGATTA
  • BKK04950 (Δ[gene|B3A07E2A61151C33B7C65D1BC58B97BFDB76852D|yddF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCATGTACGATTCAACCC, downstream forward: _UP4_TTATTAACTCGGTTAGATTA