SubtiBank SubtiBank
yraK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yraK

unknown
locus
BSU_26910
pI
7.44
mw
25.40 kDa
protein length
271 aa Sequence Blast
gene length
816 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,749,660 → 2,750,475

    The protein

    Protein family

  • [SW|AB hydrolase superfamily] (according to UniProt)
  • [SW|Domains]

  • AB hydrolase domain (aa 24 ... 124) [pubmed|25331869]
  • Structure

  • [PDB|4NZZ] (from B. megaterium, 24% identity)
  • Biological materials

    Mutant

  • MGNA-A236 (yraK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/236 NBRP B. subtilis, Japan]
  • BKE26910 (Δ[gene|B387EFFFC9DE93E6EB154159109F80891A2E7163|yraK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTAGGACCTTCCTTT, downstream forward: _UP4_TAAGGATTGATTAAAATTTT
  • BKK26910 (Δ[gene|B387EFFFC9DE93E6EB154159109F80891A2E7163|yraK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTAGGACCTTCCTTT, downstream forward: _UP4_TAAGGATTGATTAAAATTTT
  • References

    Research papers

  • 25331869