SubtiBank SubtiBank
coaA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

coaA

type I pantothenate kinase, major enzyme
locus
BSU_23760
pI
5.89
mw
36.49 kDa
protein length
319 aa Sequence Blast
gene length
960 bp Sequence Blast
function
biosynthesis of coenzyme A
product
pantothenate kinase
essential
no
ec
2.7.1.33
synonyms
yqjS

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.4|Biosynthesis of coenzyme A]
  • Gene

    Coordinates
    2,468,549 → 2,469,508

    The protein

    Catalyzed reaction/ biological activity

  • (R)-pantothenate + ATP --> (R)-4'-phosphopantothenate + ADP + H+ (according to UniProt)
  • Protein family

  • prokaryotic pantothenate kinase family (single member, according to UniProt)
  • Structure

  • [PDB|1SQ5] (from ''Escherichia coli'', 49% identity, 67% similarity) [Pubmed|15136582]
  • Expression and Regulation

    Operons

    genes
    [gene|35B40D812B123766B469B8E5C0FE0EB69F671E4E|yqjP]-[gene|0927C7D45721F47F5ED2646CAAC324A308FD7724|yqjQ]-[gene|4E7390A74A8261E8B732E94859E90FE256AD64EE|dsdA]-[gene|B3362449EF3C9D533090FBD7E7333A3CC5D902CB|coaA]-[gene|441DCE4251C83FCBB01BC58720900365BFE7BB3D|yqjT]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C399 (yqjS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2397 NBRP B. subtilis, Japan]
  • BKE23760 (Δ[gene|B3362449EF3C9D533090FBD7E7333A3CC5D902CB|coaA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGTTTACACCTGACTCT, downstream forward: _UP4_GTGTTGGTAAGGAGGGTATG
  • BKK23760 (Δ[gene|B3362449EF3C9D533090FBD7E7333A3CC5D902CB|coaA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGTTTACACCTGACTCT, downstream forward: _UP4_GTGTTGGTAAGGAGGGTATG
  • References

  • 1328157,24784177