SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


lipoprotein, elemental iron uptake system (binding protein), high affinity uptake of ferric iron (Fe(III))
42.63 kDa
protein length
385 aa Sequence Blast
gene length
1158 bp Sequence Blast
elemental iron uptake
elemental iron uptake system (binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Metal ion transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW|Elemental iron transport system]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW|Elemental iron transport system]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,927,951 → 3,929,108

    The protein

    Catalyzed reaction/ biological activity

  • binds ferric iron (Fe(III)) with strong selectivity [Pubmed|23764491]
  • Protein family

  • EfeM/EfeO family (single member, according to UniProt)
  • Structure

  • [PDB|3AT7] (from ''Sphingomonas sp.'', 40% identity) [Pubmed|21238429]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • extracytosolic lipoprotein [Pubmed|23764491]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23764491], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9683469], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • immediately induced upon iron starvation (first wave to allow iron uptake) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [Pubmed|29133393,12354229]
  • view in new tab

    Biological materials


  • MGNA-B227 (ywbM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE38270 (Δ[gene|B31884DC49684A276D65E21A5F59AFDADEB9749C|efeO]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGATACAGCGATTTTTGTGA, downstream forward: _UP4_CTATAAAAGGAGTTTTGTAA
  • BKK38270 (Δ[gene|B31884DC49684A276D65E21A5F59AFDADEB9749C|efeO]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGATACAGCGATTTTTGTGA, downstream forward: _UP4_CTATAAAAGGAGTTTTGTAA
  • References

  • 16672620,9353933,12354229,18763711,23180473,23764491,21238429,27795321,29133393