SubtiBank SubtiBank
efeO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

efeO

lipoprotein, elemental iron uptake system (binding protein), high affinity uptake of ferric iron (Fe(III))
locus
BSU_38270
pI
4.71
mw
42.63 kDa
protein length
385 aa Sequence Blast
gene length
1158 bp Sequence Blast
function
elemental iron uptake
product
elemental iron uptake system (binding protein)
essential
no
synonyms
ywbM

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.5|Metal ion transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.3|Acquisition of iron] → [category|SW 1.3.3.2|Elemental iron transport system]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.5|Elemental iron transport system]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,927,951 → 3,929,108

    The protein

    Catalyzed reaction/ biological activity

  • binds ferric iron (Fe(III)) with strong selectivity [Pubmed|23764491]
  • Protein family

  • EfeM/EfeO family (single member, according to UniProt)
  • Structure

  • [PDB|3AT7] (from ''Sphingomonas sp.'', 40% identity) [Pubmed|21238429]
  • [SW|Localization]

  • membrane [Pubmed|18763711]
  • extracytosolic lipoprotein [Pubmed|23764491]
  • Expression and Regulation

    Operons

    genes
    [gene|3BED98E311EF380AE77327C7F0A83254805089C0|efeU]-[gene|B31884DC49684A276D65E21A5F59AFDADEB9749C|efeO]-[gene|3985F88334D7B034A66473C5BB39188AB61A65F6|efeB]
    description
    [Pubmed|9353933]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|23764491], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9683469], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • immediately induced upon iron starvation (first wave to allow iron uptake) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [Pubmed|29133393,12354229]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B227 (ywbM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1226 NBRP B. subtilis, Japan]
  • BKE38270 (Δ[gene|B31884DC49684A276D65E21A5F59AFDADEB9749C|efeO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGATACAGCGATTTTTGTGA, downstream forward: _UP4_CTATAAAAGGAGTTTTGTAA
  • BKK38270 (Δ[gene|B31884DC49684A276D65E21A5F59AFDADEB9749C|efeO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGATACAGCGATTTTTGTGA, downstream forward: _UP4_CTATAAAAGGAGTTTTGTAA
  • References

  • 16672620,9353933,12354229,18763711,23180473,23764491,21238429,27795321,29133393