SubtiBank SubtiBank
ypuD
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ypuD

putative intramembrane metalloprotease
locus
BSU_23300
pI
7.03
mw
12.61 kDa
protein length
114 aa Sequence Blast
gene length
345 bp Sequence Blast
function
unknown
product
putative intramembrane metalloprotease
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    2,431,737 → 2,432,081

    Expression and Regulation

    Operons

    genes
    [gene|B2DC4E57065C76E3A67D05BDDF53B7067345B94B|ypuD]
    description
    [Pubmed|7934830]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced by DNA damage ([protein|search|LexA]) [Pubmed|16267290]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A092 (ypuD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/92 NBRP B. subtilis, Japan]
  • BKE23300 (Δ[gene|B2DC4E57065C76E3A67D05BDDF53B7067345B94B|ypuD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTAAACCTCCAGCCA, downstream forward: _UP4_TAAAAAACATCACCTTTCGG
  • BKK23300 (Δ[gene|B2DC4E57065C76E3A67D05BDDF53B7067345B94B|ypuD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTAAACCTCCAGCCA, downstream forward: _UP4_TAAAAAACATCACCTTTCGG
  • References

    Reviews

  • 29343670
  • Original publications

  • 16267290,11544224,7934830,18179421