SubtiBank SubtiBank
kinA [2019-07-31 13:50:36]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

kinA [2019-07-31 13:50:36]

two-component sensor kinase, phosphorylates [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|Spo0F], part of the [SW|phosphorelay]
68.99 kDa
protein length
606 aa Sequence Blast
gene length
1821 bp Sequence Blast
initiation of sporulation
two-component sensor kinase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of two-component response regulators] → [category|SW|Two-component sensor kinase]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW|The kinases]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW|The kinases]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    1,470,026 → 1,471,846

    The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of [protein|9896B99346B0D3F6D57F57377DB253B46135A37A|Spo0F]
  • mainly active in the older, inner regions of a colony (with [protein|2111AC1AE49D1006E10DC127BF5B7A0327DE94A7|KinB]) [Pubmed|21097618]
  • [SW|Domains]

  • three tandem [SW|PAS domain]s in the N-terminal region of KinA, the [SW|second PAS] domain is the major N-terminal determinant of KinA dimerization [Pubmed|23504013]
  • the first [SW|PAS domain] is required for NAD(+) binding [Pubmed|23599347]
  • C-terminal histidine phosphotransferase domain
  • Modification

  • autophosphorylation on a His residue
  • Effectors of protein activity

  • interaction with [protein|5A5E17D39296FECC1C03B1A7791AB1065BB4E4DF|PxpB] or [protein|CEFD10FAFA0DBC83CD2B61DAC9339FEE025B1611|Sda] inhibits autophosphorylation of [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|KinA] [Pubmed|9334321,15023339]
  • autophosphorylation is inhibited by [protein|E5E2994D96FCECEE75E15136A08308C7B6C1C183|SivA] and [protein|E06A3392E644FEDC6F46ED41BBE89168F59B76B3|BslA] [Pubmed|23335417]
  • activated by interaction with NAD(+) that indicated poor respiratory activity of the cell [Pubmed|23599347], this has been falsified [pubmed|28449380]
  • Structure

  • [PDB|2VLG] (PAS domain)
  • [SW|Localization]

  • cytoplasm
  • additional information

  • the protein forms tetramers [pubmed|28449380]
  • Expression and Regulation



    sigma factors

  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|1569009], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|9644251], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [regulon|stringent response|stringent response]: positive regulation, in [regulon|stringent response|stringent response]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|9644251]
  • additional information

  • promoter-up mutations or high artificial expression that render ''[SW|kinA]'' independent from [SW|SigH], allow [SW|sporulation] at high salinity [Pubmed|26712348]
  • view in new tab

    Biological materials


  • BKE13990 (Δ[gene|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|kinA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGAATCCCTCCTTTGCA, downstream forward: _UP4_TTTCCAAAAAAATAAAAACA
  • BKK13990 (Δ[gene|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|kinA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGAATCCCTCCTTTGCA, downstream forward: _UP4_TTTCCAAAAAAATAAAAACA
  • References


  • 22303284
  • Original Publications

  • 23169620,20511506,19561131,20413551,1846779,11292798,16166384,11734624,9299348,12067336,18174125,10094672,11069677,15023339,2509430,17350039,9334321,9477965,9644251,1569009,20081035,21097618,21926229,22303282,22670053,23335417,23378509,23504013,23599347,25598361,26055117,26165942,26657919,26712348,27216630,28449380,18324779,28838935