SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to glucose-1-phosphate cytidylyltransferase
28.52 kDa
protein length
254 aa Sequence Blast
gene length
765 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    798,469 → 799,233

    The protein

    Catalyzed reaction/ biological activity

  • α-D-glucose 1-phosphate + CTP + H+ --> CDP-D-glucose + diphosphate (according to UniProt)
  • Protein family

  • cytidylyltransferase family (with [protein|CF9633F769263C6D16EE778F6BD2ECF1995F512A|IspD] and [protein|8620DA76A1953D7ACDFA7E46ED81EF1A0D97999C|TagD], according to UniProt)
  • glucose-1-phosphate cytidylyltransferase family (single member, according to UniProt)
  • Structure

  • [PDB|1TZF] (from ''Salmonella Typhi'', 43% identity)
  • Expression and Regulation



    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, internal promoter in [protein|E3481379D3FEC02C35CB4BE17A5246A208C5C86D|YfnE] open reading frame [Pubmed|15383836], see [ DBTBS] for details, in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|26577401], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed during sporulation ([protein|search|SigK]) [Pubmed|15383836]
  • view in new tab

    Biological materials


  • MGNA-C227 (yfnH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE07270 (Δ[gene|B25AE6979AF12628780C4489FFED966C6B31968A|yfnH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTACCCCTCATCTCT, downstream forward: _UP4_GTATGGAAGGTATGGTGAAT
  • BKK07270 (Δ[gene|B25AE6979AF12628780C4489FFED966C6B31968A|yfnH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTACCCCTCATCTCT, downstream forward: _UP4_GTATGGAAGGTATGGTGAAT
  • References

  • 15383836,26577401