SubtiBank SubtiBank
adhR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

adhR

transcriptional activator ([SW|MerR family]) of [gene|352544F3E79943E94E28A6EB5F4C543B529A02D1|adhA]-[gene|0960F1856A81237DBA6AF1FAF36172A63ECBE2D5|yraA], responsive to formaldehyde and methylglyoxal
locus
BSU27000
pI
9.64
mw
16.30 kDa
protein length
140 aa Sequence Blast
gene length
423 bp Sequence Blast
function
regulation of the protective response to formaldehyde and methylglyoxal
product
transcriptional activator ([SW|MerR family])
essential
no
synonyms
yraB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    2,755,382 → 2,755,804

    The protein

    Protein family

  • [SW|MerR family]
  • Modification

  • activity probably redox-controlled via thiol-(S)-alkylation at Cys-52 by aldehydes [Pubmed|19170879]
  • Structure

  • [PDB|3GP4] (from Listeria monocytogenes, 47% identity)
  • [SW|Localization]

  • cytoplasmic
  • Expression and Regulation

    Operons

    genes
    [gene|B24BA6ABCAF7325EC5F8B2655CA182FFC23395FD|adhR]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A238 (yraB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/238 NBRP B. subtilis, Japan]
  • BKE27000 (Δ[gene|B24BA6ABCAF7325EC5F8B2655CA182FFC23395FD|adhR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCTTCACCTCTCTAT, downstream forward: _UP4_TAGCATTCTTTGCGTGTGAA
  • BKK27000 (Δ[gene|B24BA6ABCAF7325EC5F8B2655CA182FFC23395FD|adhR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCTTCACCTCTCTAT, downstream forward: _UP4_TAGCATTCTTTGCGTGTGAA
  • labs

  • [SW|Haike Antelmann],University of Greifswald, Germany
  • References

  • 21722790