SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcriptional activator ([SW|MerR family]) of [gene|352544F3E79943E94E28A6EB5F4C543B529A02D1|adhA]-[gene|0960F1856A81237DBA6AF1FAF36172A63ECBE2D5|yraA], responsive to formaldehyde and methylglyoxal
16.30 kDa
protein length
140 aa Sequence Blast
gene length
423 bp Sequence Blast
regulation of the protective response to formaldehyde and methylglyoxal
transcriptional activator ([SW|MerR family])

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    2,755,382 → 2,755,804

    The protein

    Protein family

  • [SW|MerR family]
  • Modification

  • activity probably redox-controlled via thiol-(S)-alkylation at Cys-52 by aldehydes [Pubmed|19170879]
  • Structure

  • [PDB|3GP4] (from Listeria monocytogenes, 47% identity)
  • [SW|Localization]

  • cytoplasmic
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A238 (yraB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE27000 (Δ[gene|B24BA6ABCAF7325EC5F8B2655CA182FFC23395FD|adhR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCTTCACCTCTCTAT, downstream forward: _UP4_TAGCATTCTTTGCGTGTGAA
  • BKK27000 (Δ[gene|B24BA6ABCAF7325EC5F8B2655CA182FFC23395FD|adhR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATCTTCACCTCTCTAT, downstream forward: _UP4_TAGCATTCTTTGCGTGTGAA
  • labs

  • [SW|Haike Antelmann],University of Greifswald, Germany
  • References

  • 21722790