SubtiBank SubtiBank
tcyN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

tcyN

cystine [SW|ABC transporter ](ATP-binding protein)
locus
BSU29340
pI
8.84
mw
29.41 kDa
protein length
259 aa Sequence Blast
gene length
780 bp Sequence Blast
function
cystine uptake
product
cystine [SW|ABC transporter ](ATP-binding protein)
essential
no
synonyms
hisP,ytmN

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.2|Uptake of amino acids]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.9|Biosynthesis/ acquisition of cysteine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,004,346 → 3,005,125

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|B453986691E1231A1C565D469A2A60EBFF2F6BD3|TcyC], [protein|F8C800CF71D21A1F3265977C4F0EE191D0FFE36A|YxeO], [protein|0D5BC94E21D51373A50D61CE3D0895B3DB28F6B3|PstBB], [protein|0F8048267EC038D8CF673317D969BA27735473A7|YvrO], [protein|468BEA9EAEA589D683DB79B2C689A5C6A22AB67F|GlnQ], [protein|6882EF93EC82872B25C88104F62D6603D2514890|ArtR], [protein|434BCED6953BE07D592AC229264C5AD0D04CBAF6|PstBA]
  • Structure

  • [PDB|2Q0H] (complex with ADP-Mg2+, Geobacillus stearothermophilus, 54% identity )
  • [SW|Localization]

  • attached to the membrane via [protein|350C97E4A4C60A6E2FF9610D50B4A49FB9F9B42D|TcyL]-[protein|B1DD32A3B3D1C0C5391A40834940257357A2F30F|TcyM] [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|E3F1B3A4086DBC40FD9AE9CD6981270FBDFA6CAF|snaA]-[gene|A6A13C54177381CE78ABA2CFC2A3F2CE12099F15|tcyJ]-[gene|A8FA40EACDB15CF53DDDA725A3AA5A6EB654FA8B|tcyK]-[gene|350C97E4A4C60A6E2FF9610D50B4A49FB9F9B42D|tcyL]-[gene|B1DD32A3B3D1C0C5391A40834940257357A2F30F|tcyM]-[gene|B24763A732111026D21C828FF9BE73FB22A123CF|tcyN]-[gene|EDC3565D90D7059A4A4C66A13EB568420F6CECD4|cmoO]-[gene|FCD25CA4414D689B217F54B0C44EB805F9590454|cmoI]-[gene|8145952307BC47805A7A9BD39418474358043BFE|cmoJ]-[gene|3D32B6C1DC9CAC615B02E14EA846648C3B0E61D6|ribR]-[gene|0DE66A10D9475DC57A140561E8532D3EC038FD6F|sndA]-[gene|910EAAF48C85D0364751EC9585121246AF677431|ytnM]
    description
    [Pubmed|15668000]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15272571], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16109943], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • [protein|741156D495BE3857683C8A0390764EAD83845ABC|AscR]: activation, [Pubmed|16109943], in [regulon|741156D495BE3857683C8A0390764EAD83845ABC|AscR regulon]
  • regulation

  • induced in the presence of methionine and taurine [Pubmed|11390694]
  • view in new tab

    Biological materials

    Mutant

  • BKE29340 (Δ[gene|B24763A732111026D21C828FF9BE73FB22A123CF|tcyN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTATGGATATTTTTAATCT, downstream forward: _UP4_GAACACATAAAGGAGCCGGT
  • BKK29340 (Δ[gene|B24763A732111026D21C828FF9BE73FB22A123CF|tcyN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTATGGATATTTTTAATCT, downstream forward: _UP4_GAACACATAAAGGAGCCGGT
  • References

  • 15262924,10092453,16109943,12193636,15668000,15272571,23944997