SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


cystine [SW|ABC transporter ](ATP-binding protein)
29.41 kDa
protein length
259 aa Sequence Blast
gene length
780 bp Sequence Blast
cystine uptake
cystine [SW|ABC transporter ](ATP-binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of amino acids]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of cysteine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,004,346 → 3,005,125

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|B453986691E1231A1C565D469A2A60EBFF2F6BD3|TcyC], [protein|F8C800CF71D21A1F3265977C4F0EE191D0FFE36A|YxeO], [protein|0D5BC94E21D51373A50D61CE3D0895B3DB28F6B3|PstBB], [protein|0F8048267EC038D8CF673317D969BA27735473A7|YvrO], [protein|468BEA9EAEA589D683DB79B2C689A5C6A22AB67F|GlnQ], [protein|6882EF93EC82872B25C88104F62D6603D2514890|ArtR], [protein|434BCED6953BE07D592AC229264C5AD0D04CBAF6|PstBA]
  • [SW|Domains]

  • [SW|ABC transporter domain] (aa 2-239) (according to UniProt)
  • Structure

  • [PDB|2Q0H] (complex with ADP-Mg2+, Geobacillus stearothermophilus, 54% identity )
  • [SW|Localization]

  • attached to the membrane via [protein|350C97E4A4C60A6E2FF9610D50B4A49FB9F9B42D|TcyL]-[protein|B1DD32A3B3D1C0C5391A40834940257357A2F30F|TcyM] [Pubmed|10092453]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15272571], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16109943], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • [protein|741156D495BE3857683C8A0390764EAD83845ABC|AscR]: activation, [Pubmed|16109943], in [regulon|741156D495BE3857683C8A0390764EAD83845ABC|AscR regulon]
  • regulation

  • induced in the presence of methionine and taurine [Pubmed|11390694]
  • view in new tab

    Biological materials


  • BKE29340 (Δ[gene|B24763A732111026D21C828FF9BE73FB22A123CF|tcyN]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTATGGATATTTTTAATCT, downstream forward: _UP4_GAACACATAAAGGAGCCGGT
  • BKK29340 (Δ[gene|B24763A732111026D21C828FF9BE73FB22A123CF|tcyN]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTATGGATATTTTTAATCT, downstream forward: _UP4_GAACACATAAAGGAGCCGGT
  • References

  • 15262924,10092453,16109943,12193636,15668000,15272571,23944997