SubtiBank SubtiBank
bstD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bstD

bacillithiol S-transferase
locus
BSU_12410
pI
5.81
mw
17.65 kDa
protein length
154 aa Sequence Blast
gene length
465 bp Sequence Blast
function
unknown
product
bacillithiol S-transferase
essential
no
synonyms
yjoA

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.7|Phosphorylation on a Tyr residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,313,840 → 1,314,304

    The protein

    Protein family

  • [SW|S-transferase-like (STL) superfamily] [pubmed|29451913]
  • [SW|DinB family] (according to UniProt)
  • Modification

  • phosphorylation on Tyr-150 [Pubmed|17218307]
  • Structure

  • [PDB|3DKA]
  • Expression and Regulation

    Operons

    genes
    [gene|B22075CDA06A94557DF83B3D29B7BF83E2A51EA5|bstD]
    description
    [Pubmed|22383849]

    additional information

  • the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A356 (yjoA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/356 NBRP B. subtilis, Japan]
  • BKE12410 (Δ[gene|B22075CDA06A94557DF83B3D29B7BF83E2A51EA5|bstD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATGATCTCCTCCATAT, downstream forward: _UP4_TAGCGTAAACAAGAAAAAAG
  • BKK12410 (Δ[gene|B22075CDA06A94557DF83B3D29B7BF83E2A51EA5|bstD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATGATCTCCTCCATAT, downstream forward: _UP4_TAGCGTAAACAAGAAAAAAG
  • References

  • 12884008,24728941,17218307,22383849,29451913