SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


41.79 kDa
protein length
382 aa Sequence Blast
gene length
1149 bp Sequence Blast
utilization of inositol hexakisphosphate (phytate)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.3|Phosphate metabolism]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    2,150,108 → 2,151,256

    The protein

    Catalyzed reaction/ biological activity

  • 1D-myo-inositol hexakisphosphate + H2O --> 1D-myo-inositol 1,2,4,5,6-pentakisphosphate + phosphate (according to UniProt)
  • [SW|Domains]

  • BPP domain (aa 27-361) (according to UniProt)
  • Structure

  • [PDB|3AMR]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • additional information

  • the gene is not expressed in 'B. subtilis' due to the absene of a functional promoter [PubMed|16980498]
  • view in new tab

    Biological materials


  • MGNA-B509 (yodV::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE19800 (Δ[gene|B1F5776C9882CDA4D97F2A2FBB01FAB34D21022B|phy]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGTACCCTCCTCTTT, downstream forward: _UP4_TAGAATAGAAAGCAGCTTGT
  • BKK19800 (Δ[gene|B1F5776C9882CDA4D97F2A2FBB01FAB34D21022B|phy]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGTACCCTCCTCTTT, downstream forward: _UP4_TAGAATAGAAAGCAGCTTGT
  • References

  • 18957862,24407511,10655618,7592393,16980498,20601512,23178368,20817675,26106383