SubtiBank SubtiBank
phy
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

phy

phytase
locus
BSU_19800
pI
4.94
mw
41.79 kDa
protein length
382 aa Sequence Blast
gene length
1149 bp Sequence Blast
function
utilization of inositol hexakisphosphate (phytate)
product
3-phytase
essential
no
ec
3.1.3.8
synonyms
yodV,yzxA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.3|Phosphate metabolism]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    2,150,108 → 2,151,256

    The protein

    Catalyzed reaction/ biological activity

  • 1D-myo-inositol hexakisphosphate + H2O --> 1D-myo-inositol 1,2,4,5,6-pentakisphosphate + phosphate (according to UniProt)
  • [SW|Domains]

  • BPP domain (aa 27-361) (according to UniProt)
  • Structure

  • [PDB|3AMR]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|B1F5776C9882CDA4D97F2A2FBB01FAB34D21022B|phy]
    description
    [Pubmed|7592393]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • additional information

  • the gene is not expressed in 'B. subtilis' due to the absene of a functional promoter [PubMed|16980498]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B509 (yodV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1508 NBRP B. subtilis, Japan]
  • BKE19800 (Δ[gene|B1F5776C9882CDA4D97F2A2FBB01FAB34D21022B|phy]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGTACCCTCCTCTTT, downstream forward: _UP4_TAGAATAGAAAGCAGCTTGT
  • BKK19800 (Δ[gene|B1F5776C9882CDA4D97F2A2FBB01FAB34D21022B|phy]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGTACCCTCCTCTTT, downstream forward: _UP4_TAGAATAGAAAGCAGCTTGT
  • References

  • 18957862,24407511,10655618,7592393,16980498,20601512,23178368,20817675,26106383