SubtiBank SubtiBank
ydzW/1
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydzW/1

putative phosphomannomutase, C-terminal part of YdzW
locus
BSU_06073
pI
0.00
mw
0.00 kDa
protein length
gene length
270 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.5|Prophage 3]
  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    Coordinates
    657,793 → 658,062

    Biological materials

    Mutant

  • BKE06073 (Δ[gene|B1AA111971FCE138D8FF9F576C1D14737D58EA28|ydzW/1]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06073 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCAGAACGGAAGGCAGCGAG, downstream forward: _UP4_TAAAAGATGGAATAATGCAA
  • BKK06073 (Δ[gene|B1AA111971FCE138D8FF9F576C1D14737D58EA28|ydzW/1]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06073 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCAGAACGGAAGGCAGCGAG, downstream forward: _UP4_TAAAAGATGGAATAATGCAA