SubtiBank SubtiBank
yndE
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yndE

part of the [protein|AE28299B0F274B189DD90554A5A4F7B9A9479B60|YndD]-[protein|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|YndE]-[protein|2211659780DEC3F4131B127E68EEF626534DF4BE|YndF] germinant receptor of unknown specificity
locus
BSU_17760
pI
9.09
mw
40.31 kDa
protein length
363 aa Sequence Blast
gene length
1092 bp Sequence Blast
function
germination
product
part of the [protein|AE28299B0F274B189DD90554A5A4F7B9A9479B60|YndD]-[protein|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|YndE]-[protein|2211659780DEC3F4131B127E68EEF626534DF4BE|YndF] germinant receptor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.4|APC superfamily]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.5|Germination/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,909,086 → 1,910,177

    The protein

    Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • [SW|Spore germination protein (SGP) (TC 2.A.3.9) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|D1AFCB1BE693AB6B8461B7764B6641E6EB1404FA|GerKB], [protein|D70EC7C02BC79BED724489ABCB6356447F215B87|GerBB], [protein|5FF739B8C087207039BB6DC293EE77F59337ED0B|GerAB]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|AE28299B0F274B189DD90554A5A4F7B9A9479B60|yndD]-[gene|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|yndE]-[gene|2211659780DEC3F4131B127E68EEF626534DF4BE|yndF]
    description
    [Pubmed|16497325]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,16497325], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|15699190,16497325]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A023 (yndE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/23 NBRP B. subtilis, Japan]
  • BKE17760 (Δ[gene|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|yndE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGACTTTATCACCATC, downstream forward: _UP4_GTCATTTCGAAATGGAGGAA
  • BKK17760 (Δ[gene|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|yndE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGACTTTATCACCATC, downstream forward: _UP4_GTCATTTCGAAATGGAGGAA
  • References

  • 15699190,16497325,10762253