SubtiBank SubtiBank
yndE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yndE

part of the [protein|AE28299B0F274B189DD90554A5A4F7B9A9479B60|YndD]-[protein|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|YndE]-[protein|2211659780DEC3F4131B127E68EEF626534DF4BE|YndF] germinant receptor of unknown specificity
locus
BSU_17760
pI
9.09
mw
40.31 kDa
protein length
363 aa Sequence Blast
gene length
1092 bp Sequence Blast
function
germination
product
part of the [protein|AE28299B0F274B189DD90554A5A4F7B9A9479B60|YndD]-[protein|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|YndE]-[protein|2211659780DEC3F4131B127E68EEF626534DF4BE|YndF] germinant receptor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.5|Germination/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,909,086 → 1,910,177

    The protein

    Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • [SW|Spore germination protein (SGP) (TC 2.A.3.9) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|D1AFCB1BE693AB6B8461B7764B6641E6EB1404FA|GerKB], [protein|D70EC7C02BC79BED724489ABCB6356447F215B87|GerBB], [protein|5FF739B8C087207039BB6DC293EE77F59337ED0B|GerAB]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|AE28299B0F274B189DD90554A5A4F7B9A9479B60|yndD]-[gene|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|yndE]-[gene|2211659780DEC3F4131B127E68EEF626534DF4BE|yndF]
    description
    [Pubmed|16497325]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,16497325], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|15699190,16497325]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A023 (yndE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/23 NBRP B. subtilis, Japan]
  • BKE17760 (Δ[gene|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|yndE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGACTTTATCACCATC, downstream forward: _UP4_GTCATTTCGAAATGGAGGAA
  • BKK17760 (Δ[gene|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|yndE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17760 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGACTTTATCACCATC, downstream forward: _UP4_GTCATTTCGAAATGGAGGAA
  • References

  • 15699190,16497325,10762253