SubtiBank SubtiBank
hemA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

hemA

glutamyl-tRNA reductase
locus
BSU_28170
pI
5.31
mw
50.68 kDa
protein length
455 aa Sequence Blast
gene length
1368 bp Sequence Blast
function
porphyrin biosynthesis
product
glutamyl-tRNA reductase
essential
no
ec
1.2.1.70
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.6|Biosynthesis of heme/ siroheme]
  • Gene

    Coordinates
    2,877,766 → 2,879,133

    The protein

    Catalyzed reaction/ biological activity

  • (S)-4-amino-5-oxopentanoate + NADP+ + tRNAGlu --> H+ + L-glutamyl-tRNAGlu + NADPH (according to UniProt)
  • Protein family

  • Glutamyl-tRNA reductase family (single member, according to UniProt)
  • Structure

  • [PDB|4N7R] (from ''Arabidopsis thaliana'', 32% identity) [Pubmed|24753615]
  • Expression and Regulation

    Operons

    count
    2
    genes
    [gene|B1413EB525000744BE8E429E760220A13BC4530D|hemA]-[gene|88616BA1E853E11BE0CB18F06287CA4C68143148|hemX]-[gene|D266E22E07B849E2AEB0EF232C49A2FE1EA4E02B|hemC]-[gene|33459D4389F85D60311FCE770BBA0ED9802BA342|hemD]-[gene|70263A55987F110209367CF45AD65A584AD3077D|hemB]-[gene|A54B2C86638D474F5F892003B42C535B5B39A42E|hemL]
    description
    [Pubmed|1672867]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1672867], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]: repression, [Pubmed|11532148], in [regulon|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR regulon]
  • regulation

  • induced by hydrogen peroxide ([protein|search|PerR]) [Pubmed|11532148]
  • view in new tab

    Biological materials

    Mutant

  • BKE28170 (Δ[gene|B1413EB525000744BE8E429E760220A13BC4530D|hemA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGCTCTAATTACACCCC, downstream forward: _UP4_CCACTTGTAAGTGAGTGAAA
  • BKK28170 (Δ[gene|B1413EB525000744BE8E429E760220A13BC4530D|hemA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGCTCTAATTACACCCC, downstream forward: _UP4_CCACTTGTAAGTGAGTGAAA
  • References

  • 10217486,8012594,7667267,1536660,1672867,8932315,11532148,24753615