SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


glucitol permease
51.59 kDa
protein length
463 aa Sequence Blast
gene length
1392 bp Sequence Blast
glucitol uptake
glucitol permease

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Carbohydrate transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of glucitol]
  • Gene

    668,601 → 669,992

    The protein

    Protein family

  • [SW|sodium:galactoside symporter (TC 2.A.2) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|F92925E2FDCFE6DDA3E87C7B541FE6A6CE5AABB8|XynP], [protein|59CD3E4C24326542D9C85BB6FE64FBF49869EB55|YjmB]
  • Structure

  • [PDB|4M64] (melibiose permease from Salmonella typhimurium, 31% identity) [pubmed|24389923]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8195086], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|926BCA197F259558F72FDCC73998497B9B167D22|GutR]: activation, [Pubmed|8195086], in [regulon|926BCA197F259558F72FDCC73998497B9B167D22|GutR regulon]
  • regulation

  • induced by glucitol ([protein|926BCA197F259558F72FDCC73998497B9B167D22|GutR]) [Pubmed|8195086]
  • view in new tab

    Biological materials


  • MGNA-C212 (ydjD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE06160 (Δ[gene|B13F7C35FBD55C674E5B19836D32279E7C1A5520|gutP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATTTCCCACCCCAAGA, downstream forward: _UP4_TAAATAGATGTAAAATTTTT
  • BKK06160 (Δ[gene|B13F7C35FBD55C674E5B19836D32279E7C1A5520|gutP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATTTCCCACCCCAAGA, downstream forward: _UP4_TAAATAGATGTAAAATTTTT
  • References

  • 12897001,8195086,24389923