SubtiBank SubtiBank
ywlB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywlB

general stress protein
locus
BSU_36960
pI
5.23
mw
16.36 kDa
protein length
147 aa Sequence Blast
gene length
444 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ipc-28d

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    Coordinates
    3,794,166 → 3,794,609

    Expression and Regulation

    Operons

    genes
    [gene|B134C16B43A13C7B068BC24171C2B9B7AEADC19D|ywlB]
    description
    [Pubmed|9353933]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A209 (ywlB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/209 NBRP B. subtilis, Japan]
  • BKE36960 (Δ[gene|B134C16B43A13C7B068BC24171C2B9B7AEADC19D|ywlB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGTTCACCCCGTTTTT, downstream forward: _UP4_TAAGTGCAGTTTATACACAT
  • BKK36960 (Δ[gene|B134C16B43A13C7B068BC24171C2B9B7AEADC19D|ywlB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGTTCACCCCGTTTTT, downstream forward: _UP4_TAAGTGCAGTTTATACACAT
  • References

  • 15805528,9353933