SubtiBank SubtiBank
glpF
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

glpF

glycerol facilitator
locus
BSU_09280
pI
9.51
mw
28.59 kDa
protein length
274 aa Sequence Blast
gene length
825 bp Sequence Blast
function
glycerol uptake
product
glycerol facilitator
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.3|Carbohydrate transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.3|Utilization of glycerol/ glycerol-3-phosphate]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,002,501 → 1,003,325

    The protein

    Protein family

  • MIP/aquaporin (TC 1.A.8) family (single member, according to UniProt)
  • Structure

  • [PDB|1FX8] (the protein from ''E. coli'', 37% identity) [Pubmed|11039922]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|B12432503801FA766D6FC90359A22A53A8E92457|glpF]-[gene|ECA8EBD553936CDD371B947D48B3C7D049B755BD|glpK]
    description
    [Pubmed|2127799]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2127799], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|38767691AE7E09F46B9E97A60BF5358C1876EDF8|GlpP]: antitermination, /antitermination via [protein|38767691AE7E09F46B9E97A60BF5358C1876EDF8|GlpP]-dependent [SW|RNA switch], in [regulon|38767691AE7E09F46B9E97A60BF5358C1876EDF8|GlpP regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: repression, [pubmed|28439033], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • regulation

  • induction by glycerol ([protein|38767691AE7E09F46B9E97A60BF5358C1876EDF8|GlpP]) [Pubmed|8436953]
  • repressed under anaerobic conditions ([protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]) [pubmed|28439033,10913079]
  • view in new tab

    Biological materials

    Mutant

  • GP99 (cat) (available in [SW|Jörg Stülke]'s lab)
  • BKE09280 (Δ[gene|B12432503801FA766D6FC90359A22A53A8E92457|glpF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCACATTCCTCCTAAA, downstream forward: _UP4_ATTTAATCAAAGGGGAGACA
  • BKK09280 (Δ[gene|B12432503801FA766D6FC90359A22A53A8E92457|glpF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCACATTCCTCCTAAA, downstream forward: _UP4_ATTTAATCAAAGGGGAGACA
  • References

  • 12850135,8436953,11929549,23033921,22900538,20817675,11039922,28439033,10913079