SubtiBank SubtiBank
katA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

katA

main vegetative catalase 1
locus
BSU_08820
pI
6.15
mw
54.57 kDa
protein length
483 aa Sequence Blast
gene length
1452 bp Sequence Blast
function
detoxification (degradation) of hydrogen peroxide
product
vegetative catalase
essential
no
ec
1.11.1.6
synonyms
kat-19

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    959,535 → 960,986

    Phenotypes of a mutant

  • increased sensitivity to oxidative stress [Pubmed|22174384]
  • increased susceptibility to Cr(VI) due to the accumulation of oxidative DNA damage [Pubmed|24973075]
  • The protein

    Catalyzed reaction/ biological activity

  • 2 H2O2 --> 2 H2O + O2 (according to UniProt)
  • Protein family

  • [SW|catalase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|DA5EB526EE8AF41BE9B837F2C276432BC4183AA1|KatX], [protein|03FE63D6AAC77D6CEB052D0BF578ACD048C772FB|KatE]
  • Modification

  • phosphorylated on Arg-366 [Pubmed|22517742]
  • [SW|Cofactors]

  • contains an iron-sulfur cluster, heme
  • Structure

  • [PDB|1SI8] (enzyme from Enterococcus faecalis, 68% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|B0A1AB6E920E6CBEE45115297599AF9A80972E38|katA]
    description
    [Pubmed|22174384]

    regulatory mechanism

  • [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]: repression, [Pubmed|11532148], in [regulon|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR regulon]
  • regulation

  • induced in the presence of hydrogen peroxide and paraquat ([protein|search|PerR]) [Pubmed|11532148,22174384]
  • view in new tab

    Biological materials

    Mutant

  • GP1726 [gene|B0A1AB6E920E6CBEE45115297599AF9A80972E38|katA]::xeo trpC2 available at Jörg Stülkes lab
  • GP1725 [gene|B0A1AB6E920E6CBEE45115297599AF9A80972E38|katA]::cat trpC2 available at Jörg Stülkes lab
  • BKE08820 (Δ[gene|B0A1AB6E920E6CBEE45115297599AF9A80972E38|katA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTATCACCTCTTGGAA, downstream forward: _UP4_TAATGGAGAAATGCAAAAAC
  • BKK08820 (Δ[gene|B0A1AB6E920E6CBEE45115297599AF9A80972E38|katA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTATCACCTCTTGGAA, downstream forward: _UP4_TAATGGAGAAATGCAAAAAC
  • References

  • 9393707,7667267,8931328,8932315,11532148,22174384,22194458,22517742,24973075,28446175