SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


main vegetative catalase 1
54.57 kDa
protein length
483 aa Sequence Blast
gene length
1452 bp Sequence Blast
detoxification (degradation) of hydrogen peroxide
vegetative catalase

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    959,535 → 960,986

    Phenotypes of a mutant

  • increased sensitivity to oxidative stress [Pubmed|22174384]
  • increased susceptibility to Cr(VI) due to the accumulation of oxidative DNA damage [Pubmed|24973075]
  • The protein

    Catalyzed reaction/ biological activity

  • 2 H2O2 = O2 + 2 H2O (according to Swiss-Prot)
  • Protein family

  • [SW|catalase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|DA5EB526EE8AF41BE9B837F2C276432BC4183AA1|KatX], [protein|03FE63D6AAC77D6CEB052D0BF578ACD048C772FB|KatE]
  • Modification

  • phosphorylated on Arg-366 [Pubmed|22517742]
  • [SW|Cofactors]

  • contains an iron-sulfur cluster, heme
  • Structure

  • [PDB|1SI8] (enzyme from Enterococcus faecalis, 68% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    regulatory mechanism

  • [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]: repression, [Pubmed|11532148], in [regulon|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR regulon]
  • regulation

  • induced in the presence of hydrogen peroxide and paraquat ([protein|search|PerR]) [Pubmed|11532148,22174384]
  • view in new tab

    Biological materials


  • GP1726 [gene|B0A1AB6E920E6CBEE45115297599AF9A80972E38|katA]::xeo trpC2 available at Jörg Stülkes lab
  • GP1725 [gene|B0A1AB6E920E6CBEE45115297599AF9A80972E38|katA]::cat trpC2 available at Jörg Stülkes lab
  • BKE08820 (Δ[gene|B0A1AB6E920E6CBEE45115297599AF9A80972E38|katA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTATCACCTCTTGGAA, downstream forward: _UP4_TAATGGAGAAATGCAAAAAC
  • BKK08820 (Δ[gene|B0A1AB6E920E6CBEE45115297599AF9A80972E38|katA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTATCACCTCTTGGAA, downstream forward: _UP4_TAATGGAGAAATGCAAAAAC
  • References

  • 9393707,7667267,8931328,8932315,11532148,22174384,22194458,22517742,24973075,28446175