SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


N-acetylmuramoyl-L-alanine amidase, spore cortex peptidoglycan synthesis
26.86 kDa
protein length
237 aa Sequence Blast
gene length
714 bp Sequence Blast
spore cortex peptidoglycan synthesis
N-acetylmuramoyl-L-alanine amidase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.5|Cell wall/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    156,612 → 157,325

    The protein

    Catalyzed reaction/ biological activity

  • formation of muramic acid delta-lacton in spore cortex peptidoglycan [Pubmed|14679227]
  • Hydrolyzes the link between N-acetylmuramoyl residues and L-amino acid residues in certain cell-wall glycopeptides (according to UniProt)
  • Protein family

  • [SW|N-acetylmuramoyl-L-alanine amidase 3 family] (according to UniProt)
  • [SW|Domains]

  • contains an amidase_3 domain (like [protein|5CDF32B0E78F01C696364555E3F0BC8DF2AA2089|CwlC], [protein|6A21293823151C6980BF52B31A4B249A8440F2E1|LytC], [protein|0AD75864794E597AA9160969ADE6FE0C7ED07B9F|YqiI], [protein|BE34A9CE3AF99E8880FC24E34E5D79A1627260AE|YrvJ])
  • Structure

  • [PDB|4RN7] (from Clostridium difficile, 30% identity, aa 43 - 234)
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,7559346], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • expressed during sporulation ([protein|search|SigG]) [Pubmed|7559346]
  • view in new tab



  • expressed during sporulation ([protein|search|SigG], [protein|search|SigE]) [Pubmed|7559346]
  • view in new tab

    Biological materials


  • BKE01530 (Δ[gene|B09FB626274B81F00A4FB42D188E089095343182|cwlD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCTTCCCCTCCCGCTT, downstream forward: _UP4_TAATGGAGGGTTTTCTTGTG
  • BKK01530 (Δ[gene|B09FB626274B81F00A4FB42D188E089095343182|cwlD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCTTCCCCTCCCGCTT, downstream forward: _UP4_TAATGGAGGGTTTTCTTGTG
  • References

  • 12646705,10498740,7559346,14679227,16267290,22123250,24405365