SubtiBank SubtiBank
yugI
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yugI

similar to the C-terminal domain of E. coli polyribonucleotide phosphorylase and to four repeated domains at the N-terminus of E. coli ribosomal protein S1, has an RNA-binding surface
locus
BSU_31390
pI
5.92
mw
14.14 kDa
protein length
130 aa Sequence Blast
gene length
393 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,225,178 → 3,225,570

    The protein

    Paralogous protein(s)

  • [protein|8EDB1BCEEE64FDAF1C9054300751FCB420658865|YabR]: 51% identity
  • [SW|Domains]

  • [SW|S1 domain] (aa 8-77) (according to UniProt)
  • Structure

  • [PDB|2K4K] [pubmed|19152054]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [PubMed|17981983]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|B0908BB4B8B569A7A78BB0B84784FD4C427C598B|yugI]
    description
    [Pubmed|9274030]

    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • [protein|search|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|yugI]' and '[protein|search|alaT]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A620 (yugI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/620 NBRP B. subtilis, Japan]
  • BKE31390 (Δ[gene|B0908BB4B8B569A7A78BB0B84784FD4C427C598B|yugI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATAACAACTCCTAAG, downstream forward: _UP4_TAAGCATGAAAAAAGCACCG
  • BKK31390 (Δ[gene|B0908BB4B8B569A7A78BB0B84784FD4C427C598B|yugI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATAACAACTCCTAAG, downstream forward: _UP4_TAAGCATGAAAAAAGCACCG
  • References

  • 17981983,19152054,19636895,9274030,11948165,20525796,15378759