SubtiBank SubtiBank
yugI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yugI

similar to the C-terminal domain of E. coli polyribonucleotide phosphorylase and to four repeated domains at the N-terminus of E. coli ribosomal protein S1, has an RNA-binding surface
locus
BSU_31390
pI
5.92
mw
14.14 kDa
protein length
130 aa Sequence Blast
gene length
393 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,225,178 → 3,225,570

    The protein

    Paralogous protein(s)

  • [protein|8EDB1BCEEE64FDAF1C9054300751FCB420658865|YabR]: 51% identity
  • [SW|Domains]

  • [SW|S1 domain] (aa 4 ... 74) (according to the Interpro database)
  • Structure

  • [PDB|2K4K] [pubmed|19152054]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [PubMed|17981983]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|B0908BB4B8B569A7A78BB0B84784FD4C427C598B|yugI]
    description
    [Pubmed|9274030]

    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • [protein|search|RelA] dependent downregulation (Class I) during stringent response [Pubmed|11948165]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|yugI]' and '[protein|search|alaT]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A620 (yugI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/620 NBRP B. subtilis, Japan]
  • BKE31390 (Δ[gene|B0908BB4B8B569A7A78BB0B84784FD4C427C598B|yugI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATAACAACTCCTAAG, downstream forward: _UP4_TAAGCATGAAAAAAGCACCG
  • BKK31390 (Δ[gene|B0908BB4B8B569A7A78BB0B84784FD4C427C598B|yugI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATAACAACTCCTAAG, downstream forward: _UP4_TAAGCATGAAAAAAGCACCG
  • References

  • 17981983,19152054,19636895,9274030,11948165,20525796,15378759