SubtiBank SubtiBank
yjcD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yjcD

similar to ATP-dependent DNA helicase
locus
BSU_11820
pI
8.02
mw
86.79 kDa
protein length
717 aa Sequence Blast
gene length
2154 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.6|DNA repair/ recombination/ based on similarity]
  • Gene

    Coordinates
    1,253,713 → 1,255,866

    The protein

    Catalyzed reaction/ biological activity

  • ATP + H2O --> ADP + H+ + phosphate (according to UniProt)
  • Protein family

  • [SW|helicase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|C73E52D214E24F21696973B19B0A44CE785D6FBA|PcrA]
  • Structure

  • [PDB|2PJR] ([protein|C73E52D214E24F21696973B19B0A44CE785D6FBA|PcrA] product complex, complex with sulphate ion, ''Geobacillus stearothermophilus'', 36% identity, 55% similarity)
  • [PDB|1PJR] ([protein|C73E52D214E24F21696973B19B0A44CE785D6FBA|PcrA] substrate complex, complex with DNA, ''Geobacillus stearothermophilus'', 36% identity, 55% similarity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|B0789A727D9E3578FF1CB6162F365F45FADB0B3E|yjcD]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A159 (yjcD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/159 NBRP B. subtilis, Japan]
  • BKE11820 (Δ[gene|B0789A727D9E3578FF1CB6162F365F45FADB0B3E|yjcD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAACGGGCTTTCCGCAAT, downstream forward: _UP4_TAACAGCCCGGCAGATTACT
  • BKK11820 (Δ[gene|B0789A727D9E3578FF1CB6162F365F45FADB0B3E|yjcD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAACGGGCTTTCCGCAAT, downstream forward: _UP4_TAACAGCCCGGCAGATTACT
  • References

  • 10199404