SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


55.12 kDa
protein length
499 aa Sequence Blast
gene length
1500 bp Sequence Blast
beta-1,4-glucan degradation

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of other polymeric carbohydrates]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    1,940,625 → 1,942,124

    The protein

    Catalyzed reaction/ biological activity

  • Endohydrolysis of (1->4)-beta-D-glucosidic linkages in cellulose, lichenin and cereal beta-D-glucans (according to UniProt)
  • Protein family

  • glycosyl hydrolase 5 (cellulase A) family (single member, according to UniProt)
  • [SW|Domains]

  • CBM3 domain (aa 350-499) (according to UniProt)
  • Structure

  • [PDB|3PZT] [Pubmed|21880019]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3106328], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials


  • 1A751 (no resistance), [Pubmed|7704256], available at [ BGSC]
  • 1A752 (no resistance), [Pubmed|7704256], available at [ BGSC]
  • 1A976 (no resistance), [Pubmed|21255377], available at [ BGSC]
  • BKE18130 (Δ[gene|B0528C4772B2357D10AEEA3C63080C5176B27E7B|bglC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTGATCTTTTCCTCC, downstream forward: _UP4_TAGTTAAGCTTTTTTTTGGC
  • BKK18130 (Δ[gene|B0528C4772B2357D10AEEA3C63080C5176B27E7B|bglC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCTGATCTTTTCCTCC, downstream forward: _UP4_TAGTTAAGCTTTTTTTTGGC
  • References

  • 18957862,3024130,21880019,3106328,23543074,27334041