SubtiBank SubtiBank
yhcD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhcD

unknown
locus
BSU_09040
pI
9.98
mw
5.83 kDa
protein length
gene length
156 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    980,313 → 980,468

    Biological materials

    Mutant

  • BKE09040 (Δ[gene|B04B4859BDB5E0C5899B92160E6895680AF15C93|yhcD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGTAAACGGATTTGCCTTTT, downstream forward: _UP4_AGGATTTTTTCCGGGAGGTA
  • BKK09040 (Δ[gene|B04B4859BDB5E0C5899B92160E6895680AF15C93|yhcD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AGTAAACGGATTTGCCTTTT, downstream forward: _UP4_AGGATTTTTTCCGGGAGGTA
  • References

  • 21815947