SubtiBank SubtiBank
yobE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yobE

similar to general secretion pathway
locus
BSU_18880
pI
5.04
mw
25.09 kDa
protein length
219 aa Sequence Blast
gene length
661 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.6|Protein secretion/ based on similarity]
  • The protein

    Protein family

  • [SW|SOS response-associated peptidase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|9459834886B4943D514137F0E51536C771154183|YoqW], [protein|46FCB8FC703E61ED6578DFE4D3FC01B9421F8247|YoaM]
  • Structure

  • [PDB|2F20] (from Bacteroides thetaiotamicron, 35% identity)
  • Biological materials

    Mutant

  • MGNA-B406 (yobE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1405 NBRP B. subtilis, Japan]
  • BKE18880 (Δ[gene|B01C362825EB84DAD70CAF2C2500DE7D3EE68E5C|yobE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCATCATCCTTTAGG, downstream forward: _UP4_TAAGTACCACTGCCATATCG
  • BKK18880 (Δ[gene|B01C362825EB84DAD70CAF2C2500DE7D3EE68E5C|yobE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTCATCATCCTTTAGG, downstream forward: _UP4_TAAGTACCACTGCCATATCG