SubtiBank SubtiBank
natA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

natA

Na+ [SW|ABC transporter ](export) (ATP-binding protein)
locus
BSU02750
pI
8.80
mw
27.73 kDa
protein length
246 aa Sequence Blast
gene length
741 bp Sequence Blast
function
sodium export
product
Na+ [SW|ABC transporter ](export) (ATP-binding protein)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.2|Exporters] → [category|SW 1.2.1.2.5|Export of ions]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW 1.3.1.2|Sodium uptake/ export]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    296,429 → 297,169

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • Structure

  • [PDB|1VPL] (from Thermotoga maritima, 38% identity)
  • [SW|Localization]

  • membrane associated (via [protein|A8ADA02BBB549866DE330040CF6D06ECC3B00099|NatB]) [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|B019FD0CB6F76C03DA5E76ABD1B324BA5E1A6936|natA]-[gene|A8ADA02BBB549866DE330040CF6D06ECC3B00099|natB]
    description
    [Pubmed|17322186]

    regulatory mechanism

  • [protein|D3F6337B94A633730E514B05CA852BE9AA3741B3|NatR]: activation, [Pubmed|17322186], in [regulon|D3F6337B94A633730E514B05CA852BE9AA3741B3|NatR regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE02750 (Δ[gene|B019FD0CB6F76C03DA5E76ABD1B324BA5E1A6936|natA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCACAATCTCCCTTAT, downstream forward: _UP4_AAGCTTGTCAGGGGGATTTC
  • BKK02750 (Δ[gene|B019FD0CB6F76C03DA5E76ABD1B324BA5E1A6936|natA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCACAATCTCCCTTAT, downstream forward: _UP4_AAGCTTGTCAGGGGGATTTC
  • References

  • 9106203,10092453,17322186