SubtiBank SubtiBank
yvcT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvcT

similar to hydroxypyruvate reductase
locus
BSU_34680
pI
5.09
mw
36.46 kDa
protein length
325 aa Sequence Blast
gene length
978 bp Sequence Blast
function
unknown
product
unknown
essential
no
ec
1.1.1.215
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,562,566 → 3,563,543

    The protein

    Catalyzed reaction/ biological activity

  • D-gluconate + NADP+ --> 2-dehydro-D-gluconate + H+ + NADPH (according to UniProt)
  • Protein family

  • D-isomer specific 2-hydroxyacid dehydrogenase family (with [protein|3769B79A180412C0FE98B3FC54BA49750BAFEDF6|YoaD] and [protein|8AD1C7C761FF8B407A973381CA135C264B995CB7|SerA], according to UniProt)
  • Structure

  • [PDB|5AOV] (from Pyrococcus furiosus, 46% identity) [pubmed|26865263]
  • Additional information

  • The gene is annotated in KEGG as gluconate 2-dehydrogenase EC 1.1.1.215. The gene is marked “similar to glycerate dehydrogenase” in MetaCyc and marked as probable EC 1.1.1.215 in Swiss-Prot. No literature/experimental evidence supporting the annotation is available. [Pubmed|19935659]
  • Expression and Regulation

    Operons

    genes
    [gene|B0145F4E13F004ECC773E8758B5844669F4C74D7|yvcT]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B633 (yvcT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1632 NBRP B. subtilis, Japan]
  • BKE34680 (Δ[gene|B0145F4E13F004ECC773E8758B5844669F4C74D7|yvcT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGGCTCCCCCTTTATGGC, downstream forward: _UP4_TAAATCAAAAATCCGGTCTG
  • BKK34680 (Δ[gene|B0145F4E13F004ECC773E8758B5844669F4C74D7|yvcT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34680 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGGCTCCCCCTTTATGGC, downstream forward: _UP4_TAAATCAAAAATCCGGTCTG
  • References

    Research papers

  • 26865263