SubtiBank SubtiBank
phoC
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

phoC

[SW|HAD superfamily] sugar phosphate phosphatase
locus
BSU_36290
pI
4.88
mw
31.80 kDa
protein length
285 aa Sequence Blast
gene length
858 bp Sequence Blast
function
detoxification of sugar phosphates
product
sugar phosphate phosphatase
essential
no
synonyms
ywpJ

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,738,343 → 3,739,200

    The protein

    Catalyzed reaction/ biological activity

  • dephosphorylates glycerol 3-phosphate and ribose 5- phosphate [pubmed|30782637]
  • Protein family

  • [SW|HAD superfamily] (according to UniProt)
  • [SW|Cof family] (according to UniProt)
  • Modification

  • phosphorylated on Arg-258 [Pubmed|22517742]
  • [SW|Cofactors]

  • Mg2+ [pubmed|30782637]
  • Structure

  • [PDB|1NRW]
  • Expression and Regulation

    Operons

    genes
    [gene|6F5831A480B72D17B7B3F0BF7AF147603B65CA49|glcR]-[gene|AF9523D3AA3C032B70175BCFFED34E9A42ED01AF|phoC]
    description
    [Pubmed|30782637,22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|30782637], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6F5831A480B72D17B7B3F0BF7AF147603B65CA49|GlcR]: repression, [pubmed|30782637], in [regulon|6F5831A480B72D17B7B3F0BF7AF147603B65CA49|GlcR regulon]
  • regulation

  • induced by phosphosugar stress [Pubmed|30782637]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A531 (ywpJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/531 NBRP B. subtilis, Japan]
  • BKE36290 (Δ[gene|AF9523D3AA3C032B70175BCFFED34E9A42ED01AF|phoC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCGCAATTAATTTCACGT, downstream forward: _UP4_TAAGTATATGTGCTGCCACA
  • BKK36290 (Δ[gene|AF9523D3AA3C032B70175BCFFED34E9A42ED01AF|phoC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCGCAATTAATTTCACGT, downstream forward: _UP4_TAAGTATATGTGCTGCCACA
  • References

  • 22383849,22517742,30782637