SubtiBank SubtiBank
glcU
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

glcU

probable glucose uptake protein
locus
BSU_03920
pI
10.67
mw
30.74 kDa
protein length
287 aa Sequence Blast
gene length
864 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ycxE

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.3|Carbohydrate transporter]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    444,461 → 445,324

    The protein

    Protein family

  • GRP transporter (TC 2.A.7.5) family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|AF5180DE23ADBBA4B58EC5D61A8C3EE08701E88B|glcU]-[gene|CA4597C6253CCF7D7954686A30AF041808BDF8E5|gdh]
    description
    [Pubmed|3141376]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|3141376], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: repression, [Pubmed|8755877], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed during sporulation ([protein|search|SigG], [SW|SpoVT]) [Pubmed|3141376,8755877]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C016 (ycxE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2014 NBRP B. subtilis, Japan]
  • BKE03920 (Δ[gene|AF5180DE23ADBBA4B58EC5D61A8C3EE08701E88B|glcU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTGGGGAACCTTCTT, downstream forward: _UP4_TCATAACAAATGGAGGAGGA
  • BKK03920 (Δ[gene|AF5180DE23ADBBA4B58EC5D61A8C3EE08701E88B|glcU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTGGGGAACCTTCTT, downstream forward: _UP4_TCATAACAAATGGAGGAGGA
  • References

  • 3141376,8755877,27766092,29512378