SubtiBank SubtiBank
ylbN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ylbN

may be required for accumulation of 23S rRNA
locus
BSU15070
pI
4.31
mw
19.85 kDa
protein length
172 aa Sequence Blast
gene length
519 bp Sequence Blast
function
accumulation of 23S rRNA
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,575,264 → 1,575,782

    The protein

    [SW|Domains]

  • [https://www.ebi.ac.uk/interpro/entry/IPR003772/taxonomy DUF177], aa 56-165
  • Modification

  • phosphorylated on Arg-158 [Pubmed|22517742]
  • Expression and Regulation

    Operons

    genes
    [gene|AF4BB5F08F805D3621597559B4C7F53A1A1CAD05|ylbN]-[gene|8C16300FC29E7DB5070367C8A2568134AF528233|rpmF]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • strongly repressed in response to glucose starvation in M9 medium [Pubmed|23033921]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B251 (ylbN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1250 NBRP B. subtilis, Japan]
  • BKE15070 (Δ[gene|AF4BB5F08F805D3621597559B4C7F53A1A1CAD05|ylbN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTATCACCTCAGGAA, downstream forward: _UP4_TAACTCTTTAAGGAGGTGGG
  • BKK15070 (Δ[gene|AF4BB5F08F805D3621597559B4C7F53A1A1CAD05|ylbN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15070 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTATCACCTCAGGAA, downstream forward: _UP4_TAACTCTTTAAGGAGGTGGG
  • References

  • 22517742,22383849,11948165,27574185