SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


may be required for accumulation of 23S rRNA
19.85 kDa
protein length
172 aa Sequence Blast
gene length
519 bp Sequence Blast
accumulation of 23S rRNA

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    1,575,264 → 1,575,782

    The protein


  • [ DUF177], aa 56-165
  • Modification

  • phosphorylated on Arg-158 [Pubmed|22517742]
  • Expression and Regulation



    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • strongly repressed in response to glucose starvation in M9 medium [Pubmed|23033921]
  • view in new tab

    Biological materials


  • MGNA-B251 (ylbN::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE15070 (Δ[gene|AF4BB5F08F805D3621597559B4C7F53A1A1CAD05|ylbN]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTATCACCTCAGGAA, downstream forward: _UP4_TAACTCTTTAAGGAGGTGGG
  • BKK15070 (Δ[gene|AF4BB5F08F805D3621597559B4C7F53A1A1CAD05|ylbN]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTATCACCTCAGGAA, downstream forward: _UP4_TAACTCTTTAAGGAGGTGGG
  • References

  • 22517742,22383849,11948165,27574185