SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


may be required for accumulation of 23S rRNA
19.85 kDa
protein length
172 aa Sequence Blast
gene length
519 bp Sequence Blast
accumulation of 23S rRNA

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    1,575,264 → 1,575,782

    The protein


  • [ DUF177], aa 56-165
  • Modification

  • phosphorylated on Arg-158 [Pubmed|22517742]
  • Expression and Regulation



    regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • strongly repressed in response to glucose starvation in M9 medium [Pubmed|23033921]
  • view in new tab

    Biological materials


  • MGNA-B251 (ylbN::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE15070 (Δ[gene|AF4BB5F08F805D3621597559B4C7F53A1A1CAD05|ylbN]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTATCACCTCAGGAA, downstream forward: _UP4_TAACTCTTTAAGGAGGTGGG
  • BKK15070 (Δ[gene|AF4BB5F08F805D3621597559B4C7F53A1A1CAD05|ylbN]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTATCACCTCAGGAA, downstream forward: _UP4_TAACTCTTTAAGGAGGTGGG
  • References

  • 22517742,22383849,11948165,27574185