SubtiBank SubtiBank
yqiK
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yqiK

cytoplasmic glycerophosphodiester phosphodiesterase
locus
BSU_24180
pI
6.43
mw
26.81 kDa
protein length
243 aa Sequence Blast
gene length
732 bp Sequence Blast
function
unknown
product
cytoplasmic glycerophosphodiester phosphodiesterase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW 2.4.1.2|Utilization of phospholipids/ based on similarity]
  • Gene

    Coordinates
    2,514,169 → 2,514,900

    The protein

    Paralogous protein(s)

  • [protein|E9BEF368F8E55888AD4849E8906E517831A882DF|GlpQ], [protein|04CACAF4F786090AB67D7C606C944F07B7A7FE55|YhdW]
  • [SW|Domains]

  • GP-PDE domain (aa 2-240) (according to UniProt)
  • Structure

  • [PDB|2PZ0] (GdpP from Thermoanaerobacter tengcongensis, 43% identity) [pubmed|18214974]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|AEA18C431FE13FC34671E673DC6733B200E342A8|yqiH]-[gene|0AD75864794E597AA9160969ADE6FE0C7ED07B9F|yqiI]-[gene|AF37A0E08AAAA9159DD1F0183A61713EF582E830|yqiK]
    description
    [Pubmed|22843846,22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22843846], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • only expressed under conditions of high osmolarity [Pubmed|32419322,22843846]
  • view in new tab

    genes
    [gene|AF37A0E08AAAA9159DD1F0183A61713EF582E830|yqiK]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • GP2384 ∆''[gene|AF37A0E08AAAA9159DD1F0183A61713EF582E830|yqiK]''::''cat'', available in [SW|Jörg Stülke]'s lab
  • MGNA-C458 (yqiK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2456 NBRP B. subtilis, Japan]
  • BKE24180 (Δ''[gene|AF37A0E08AAAA9159DD1F0183A61713EF582E830|yqiK]''::''ermC'') (available in the BGSC and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • BKE24180 (Δ[gene|AF37A0E08AAAA9159DD1F0183A61713EF582E830|yqiK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTTCACCTCAAACCC, downstream forward: _UP4_TAGTTGTTAGAAGGAGGCTG
  • BKK24180 (Δ[gene|AF37A0E08AAAA9159DD1F0183A61713EF582E830|yqiK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTTCACCTCAAACCC, downstream forward: _UP4_TAGTTGTTAGAAGGAGGCTG
  • References

  • 22383849,22843846,18214974