SubtiBank SubtiBank
yqiK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqiK

cytoplasmic glycerophosphodiester phosphodiesterase
locus
BSU_24180
pI
6.43
mw
26.81 kDa
protein length
243 aa Sequence Blast
gene length
732 bp Sequence Blast
function
unknown
product
cytoplasmic glycerophosphodiester phosphodiesterase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW 2.4.1.2|Utilization of phospholipids/ based on similarity]
  • Gene

    Coordinates
    2,514,169 → 2,514,900

    The protein

    Paralogous protein(s)

  • [protein|E9BEF368F8E55888AD4849E8906E517831A882DF|GlpQ], [protein|04CACAF4F786090AB67D7C606C944F07B7A7FE55|YhdW]
  • [SW|Domains]

  • GP-PDE domain (aa 2-240) (according to UniProt)
  • Structure

  • [PDB|2PZ0] (GdpP from Thermoanaerobacter tengcongensis, 43% identity) [pubmed|18214974]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|AEA18C431FE13FC34671E673DC6733B200E342A8|yqiH]-[gene|0AD75864794E597AA9160969ADE6FE0C7ED07B9F|yqiI]-[gene|AF37A0E08AAAA9159DD1F0183A61713EF582E830|yqiK]
    description
    [Pubmed|22843846,22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22843846], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • only expressed under conditions of high osmolarity [Pubmed|22843846]
  • view in new tab

    genes
    [gene|AF37A0E08AAAA9159DD1F0183A61713EF582E830|yqiK]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • GP2384 ∆''[gene|AF37A0E08AAAA9159DD1F0183A61713EF582E830|yqiK]''::''cat'', available in [SW|Jörg Stülke]'s lab
  • MGNA-C458 (yqiK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2456 NBRP B. subtilis, Japan]
  • BKE24180 (Δ''[gene|AF37A0E08AAAA9159DD1F0183A61713EF582E830|yqiK]''::''ermC'') (available in the BGSC and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • BKE24180 (Δ[gene|AF37A0E08AAAA9159DD1F0183A61713EF582E830|yqiK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTTCACCTCAAACCC, downstream forward: _UP4_TAGTTGTTAGAAGGAGGCTG
  • BKK24180 (Δ[gene|AF37A0E08AAAA9159DD1F0183A61713EF582E830|yqiK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTTCACCTCAAACCC, downstream forward: _UP4_TAGTTGTTAGAAGGAGGCTG
  • References

  • 22383849,22843846,18214974