SubtiBank SubtiBank
lytG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lytG

peptidoglycan N-acetylglucosaminidase
locus
BSU_31120
pI
8.28
mw
31.75 kDa
protein length
282 aa Sequence Blast
gene length
849 bp Sequence Blast
function
cell wall turnover
product
peptidoglycan N-acetylglucosaminidase
essential
no
synonyms
yubE

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.1|Autolysis]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.5|N-acetyl-β-D-glucosaminidases]
  • Gene

    Coordinates
    3,190,834 → 3,191,682

    The protein

    Catalyzed reaction/ biological activity

  • hydrolysis of the glycosidic bond between N-acetyl-β-d-glucosamine residues and adjacent monosaccharides [Pubmed|18266855]
  • Protein family

  • glycosyl hydrolase 73 family (with [protein|29219315D31BA4ADE41687EFF17FE41D6C23D157|LytD], according to UniProt)
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|AF0BC3D534BC2CCCAAB53B286CF4286E58A8A338|lytG]-[gene|E1549CE5B1648EBD1E23890D97F0B545A9EC10F6|yubF]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A027 (yubE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/27 NBRP B. subtilis, Japan]
  • BKE31120 (Δ[gene|AF0BC3D534BC2CCCAAB53B286CF4286E58A8A338|lytG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAAACCTTCCTTCGAA, downstream forward: _UP4_TAAGCCCTTTTTACTGGTAT
  • BKK31120 (Δ[gene|AF0BC3D534BC2CCCAAB53B286CF4286E58A8A338|lytG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAAAACCTTCCTTCGAA, downstream forward: _UP4_TAAGCCCTTTTTACTGGTAT
  • References

    Reviews

  • 18266855
  • Original publications

  • 12525152,17427287,28448118