SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


small acid-soluble spore protein (minor alpha/beta-type SASP)
6.67 kDa
protein length
gene length
195 bp Sequence Blast
protection of spore DNA
small acid-soluble spore protein (minor alpha/beta-type SASP)

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Small acid-soluble spore proteins]
  • Gene

    1,413,800 → 1,413,994

    The protein

    Protein family

  • [SW|Alpha/beta-type SASP family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|80B5DAED9B4BD015D877DB4819AB25FC5F165C6D|SspA], [protein|28F47ADECD376494878AE58B395B3A2616B6B5DF|SspB], [protein|9E1B3A6289F2C94F9088FA14CE8939E208DE9FEA|SspC]
  • Structure

  • [PDB|2Z3X] ([protein|9E1B3A6289F2C94F9088FA14CE8939E208DE9FEA|SspC]-DNA complex, 59% identity)
  • Expression and Regulation



    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: activation, [Pubmed|8755877], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigG], [SW|SpoVT]) [Pubmed|15699190,8755877]
  • view in new tab

    Biological materials


  • BKE13470 (Δ[gene|AEFA4CE1588C7EC7FCB01312A172093D12B2B206|sspD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTCATCTCCTTTT, downstream forward: _UP4_GGCACAACTAAATAAATTCA
  • BKK13470 (Δ[gene|AEFA4CE1588C7EC7FCB01312A172093D12B2B206|sspD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTTCATCTCCTTTT, downstream forward: _UP4_GGCACAACTAAATAAATTCA
  • References

  • 3009398,15699190,8755877