SubtiBank SubtiBank
guaD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

guaD

guanine deaminase, general stress protein, important for survival of ethanol and paraquat stresses
locus
BSU13170
pI
5.00
mw
17.01 kDa
protein length
156 aa Sequence Blast
gene length
471 bp Sequence Blast
function
deamination of guanine to xanthine, purine salvage and interconversion
product
guanine deaminase
essential
no
ec
3.5.4.3
synonyms
gde,yknA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.3|Purine salvage and interconversion]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    1,382,677 → 1,383,147

    The protein

    Catalyzed reaction/ biological activity

  • Guanine + H2O = xanthine + NH3 (according to Swiss-Prot)
  • Protein family

  • [SW|Cytidine and deoxycytidylate deaminase family] (according to UniProt)
  • Structure

  • [PDB|1WKQ]
  • Expression and Regulation

    Operons

    genes
    [gene|AEEC5CAC20D3A182074332087FD3CDCCF05F28CC|guaD]
    description
    [Pubmed|11101664]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11101664], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: activation, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A752 (yknA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/752 NBRP B. subtilis, Japan]
  • BKE13170 (Δ[gene|AEEC5CAC20D3A182074332087FD3CDCCF05F28CC|guaD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCAATCCCTCCTGTCA, downstream forward: _UP4_TAAAAGGATCAGGCATGCGC
  • BKK13170 (Δ[gene|AEEC5CAC20D3A182074332087FD3CDCCF05F28CC|guaD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCAATCCCTCCTGTCA, downstream forward: _UP4_TAAAAGGATCAGGCATGCGC
  • References

  • 11101664,12029039,15180998,15805528,11344136,22582280