SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


guanine deaminase, general stress protein, important for survival of ethanol and paraquat stresses
17.01 kDa
protein length
156 aa Sequence Blast
gene length
471 bp Sequence Blast
deamination of guanine to xanthine, purine salvage and interconversion
guanine deaminase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Purine salvage and interconversion]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    1,382,677 → 1,383,147

    The protein

    Catalyzed reaction/ biological activity

  • guanine + H+ + H2O --> NH4+ + xanthine (according to UniProt)
  • Protein family

  • [SW|Cytidine and deoxycytidylate deaminase family] (according to UniProt)
  • [SW|Domains]

  • [SW|CMP/dCMP-type deaminase domain] (aa 1-132) (according to UniProt)
  • Structure

  • [PDB|1WKQ]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11101664], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: activation, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials


  • MGNA-A752 (yknA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE13170 (Δ[gene|AEEC5CAC20D3A182074332087FD3CDCCF05F28CC|guaD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCAATCCCTCCTGTCA, downstream forward: _UP4_TAAAAGGATCAGGCATGCGC
  • BKK13170 (Δ[gene|AEEC5CAC20D3A182074332087FD3CDCCF05F28CC|guaD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCCAATCCCTCCTGTCA, downstream forward: _UP4_TAAAAGGATCAGGCATGCGC
  • References

  • 11101664,12029039,15180998,15805528,11344136,22582280