SubtiBank SubtiBank
yqiH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqiH

extracellular lipoprotein
locus
BSU_24200
pI
4.86
mw
10.60 kDa
protein length
gene length
294 bp Sequence Blast
function
unknown
product
extracellular lipoprotein
essential
no
synonyms
yzpA

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,515,614 → 2,515,907

    The protein

    [SW|Localization]

  • extracelular (signal peptide) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|AEA18C431FE13FC34671E673DC6733B200E342A8|yqiH]-[gene|0AD75864794E597AA9160969ADE6FE0C7ED07B9F|yqiI]-[gene|AF37A0E08AAAA9159DD1F0183A61713EF582E830|yqiK]
    description
    [Pubmed|22843846,22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22843846], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • only expressed under conditions of high osmolarity [Pubmed|22843846]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C371 (yqiH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2369 NBRP B. subtilis, Japan]
  • BKE24200 (Δ[gene|AEA18C431FE13FC34671E673DC6733B200E342A8|yqiH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATGACCACCTCTTCCTG, downstream forward: _UP4_AACTCGTGACCGGAGGGAGT
  • BKK24200 (Δ[gene|AEA18C431FE13FC34671E673DC6733B200E342A8|yqiH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATGACCACCTCTTCCTG, downstream forward: _UP4_AACTCGTGACCGGAGGGAGT
  • References

  • 22383849,22843846