SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


co-sigma factor (with [protein|6359025A73C0BD313F5BCC6F56FE88B820902AAA|SigO])
9.00 kDa
protein length
gene length
240 bp Sequence Blast
[SW|RNA polymerase] [SW|sigma factor]
co-sigma factor (with [protein|6359025A73C0BD313F5BCC6F56FE88B820902AAA|SigO])

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW|Sigma factors]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.3|Acid stress proteins (controlled by YvrI-YvrHa)]
  • Gene

    3,409,219 3,409,458

    The protein


  • corresponds to region 2 of a [SW|sigma factor] [Pubmed|19940246]
  • Expression and Regulation



    sigma factors

  • [protein|6359025A73C0BD313F5BCC6F56FE88B820902AAA|SigO]: sigma factor, [Pubmed|19047353], in [regulon|6359025A73C0BD313F5BCC6F56FE88B820902AAA|SigO regulon]
  • [protein|AE8D4F07EFB17DA727D80229C3E72075928AA352|RsoA]: sigma factor, in [regulon|AE8D4F07EFB17DA727D80229C3E72075928AA352|RsoA regulon]
  • regulatory mechanism

  • [protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb]: activation, [Pubmed|16306698], in [regulon|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb regulon]
  • regulation

  • induced by acidic growth conditions [Pubmed|19047353]
  • view in new tab

    Biological materials


  • BKE33222 ([gene|AE8D4F07EFB17DA727D80229C3E72075928AA352|rsoA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGTTCAAACTGGCCGTCCA, downstream forward: _UP4_TAATATTTTCATATGAAAAA
  • BKK33222 ([gene|AE8D4F07EFB17DA727D80229C3E72075928AA352|rsoA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGTTCAAACTGGCCGTCCA, downstream forward: _UP4_TAATATTTTCATATGAAAAA
  • labs

  • [SW|John Helmann], Cornell University, USA [ Homepage]
  • References

  • 18573182,19940246,26651345,19047353,26367498,26400263,27558998