SubtiBank SubtiBank
yneI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yneI

two-component response regulator
locus
BSU17940
pI
6.95
mw
13.40 kDa
protein length
120 aa Sequence Blast
gene length
363 bp Sequence Blast
function
unknown
product
two-component response regulator
essential
no
synonyms
yoxH,ccdB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.1|Two-component system response regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    Coordinates
    1,924,030 1,924,392

    The protein

    Paralogous protein(s)

  • [protein|2F0495C7EAB81BDB1F3181677C555537BD2A972F|CheY]
  • Structure

  • [PDB|1TMY] ([protein|2F0495C7EAB81BDB1F3181677C555537BD2A972F|CheY] from ''Thermotoga maritima'', 57% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|27A25671205E9F6475A1EF00C72F9239AA2A767A|ccdA]-[gene|AE823A0A652509787EA032F122E59F3C3645385F|yneI]-[gene|D869177D5B1CE8B72AF89A18F03D8176ADA42664|yneJ]
    description
    [Pubmed|9068642]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10781554], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE17940 (''yneI''::''ermC'') (available at the [http://www.bgsc.org/ BGSC] and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]
  • GP1866 (''yneI''::''ermC'') (available in [SW|Jörg Stülke]'s lab)
  • BKE17940 ([gene|AE823A0A652509787EA032F122E59F3C3645385F|yneI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCCCCTCCAACAATC, downstream forward: _UP4_TAAAGTCATTTCTTTTCAAA
  • BKK17940 ([gene|AE823A0A652509787EA032F122E59F3C3645385F|yneI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCCCCTCCAACAATC, downstream forward: _UP4_TAAAGTCATTTCTTTTCAAA
  • References

  • 9068642,10781554,10094672