SubtiBank SubtiBank
aspB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

aspB

aspartate transaminase
locus
BSU_22370
pI
5.30
mw
42.93 kDa
protein length
393 aa Sequence Blast
gene length
1182 bp Sequence Blast
function
biosynthesis of aspartate
product
aspartate transaminase
essential
no
ec
2.6.1.1
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.5|Biosynthesis/ acquisition of aspartate/ asparagine]
  • Gene

    Coordinates
    2,347,660 2,348,841

    Phenotypes of a mutant

  • auxotrophic for aspartate and asparagine [pubmed|29995990]
  • lyses on DSM dporulation medium due to the inhibition of GltT-mediated Asp transport by glutamate and resulting depletion of meso-diaminopimelate [pubmed|29995990]
  • The protein

    Catalyzed reaction/ biological activity

  • 2-oxoglutarate + L-aspartate --> L-glutamate + oxaloacetate (according to UniProt)
  • Protein family

  • [SW|class-I pyridoxal-phosphate-dependent aminotransferase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|62A9CD9AF72D0A48EC5ABC1585E2D8636D36D021|AlaT], [protein|094AE3AC8DFAFC8048ADAAB34F76DF2562D80CE7|PatA]
  • [SW|Cofactors]

  • PLP
  • Structure

  • [PDB|1J32] (from ''Phormidium lapideum'', 45% identity, 66% similarity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|08F907C6F47BDEB4DC9A9F136CDC6A4063AC0140|ypmA]-[gene|D3629004F3B54D11566AE15227174F9EB7784201|tseB]-[gene|AE802E1D4F827DED3A5D953C7D034E6A3554C45F|aspB]
    description
    [Pubmed|29995990,22383849]
    view in new tab

    genes
    [gene|D3629004F3B54D11566AE15227174F9EB7784201|tseB]-[gene|AE802E1D4F827DED3A5D953C7D034E6A3554C45F|aspB]
    description
    [Pubmed|22383849]

    regulation

  • constitutive
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials

    Mutant

  • BKE22370 ([gene|AE802E1D4F827DED3A5D953C7D034E6A3554C45F|aspB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTTGAACTCCCCCTAAT, downstream forward: _UP4_TAACAGATCAAAAAGCGGCT
  • BKK22370 ([gene|AE802E1D4F827DED3A5D953C7D034E6A3554C45F|aspB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTTGAACTCCCCCTAAT, downstream forward: _UP4_TAACAGATCAAAAAGCGGCT
  • References

  • 15378759,28232482,26883633,29995990